Download cáncer de pulmón

CÁNCER DE PULMÓN
Curso de la ESO en español
17-18 febrero 2005
Coordinadores: M. Sánchez-Céspedes, ES - R. Rosell, ES
Auditorio Centro Nacional de Investigación Oncológicas (CNIO)
Melchor Fernández Almagro, 3
28029 Madrid
www.cnio.es
La reproducción del material de este libro está condicionada a la obtención previa del permiso correspondiente de los ponentes.
ÍNDICE
Introducción . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
7
Programa del curso . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
8
Lista de ponentes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
10
Contribuciones de los ponentes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
13
Sesión I: Etiología y bases moleculares del cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . .
Moderador: Ángel López-Encuentra
Epidemiología del cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
José Franco
Factores de susceptibilidad al cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . .
Juan Miguel Barros Dios
Carcinógenos y origen del cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Julián Carretero
Alteraciones genético-moleculares en el cáncer de pulmón . . . . . . . . . . . . . . . . . . . .
Montserrat Sánchez-Céspedes
Telómeros y telomerasa en cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Jean Charles Soria
Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón . . . . .
Esteve Fernández-Muñoz
Sesión II: Alteraciones genético-moleculares en cáncer de pulmón: utilización clínica . . . . . . .
Moderador: Rafael Rosell
Clasificación histológica y lesiones preneoplásicas en cáncer de pulmón . . . . . . . . . . .
José Ramírez
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón .
Luis M. Montuenga
Factores pronósticos en cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Ángel López-Encuentra
Aplicación de las matrices de tejido ("tissue microarrays") al estudio de los carcinomas
de pulmón no microcíticos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Fernando López-Ríos
Metilación y cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Manel Esteller
Sesión III: Perspectivas de las nuevas terapias en cáncer de pulmón . . . . . . . . . . . . . . . . . .
Moderador: Montserrat Sánchez-Céspedes
Dianas moleculares y nuevas terapias . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Rafael Rosell
Factores de resistencia a quimioterapia en cáncer de pulmón . . . . . . . . . . . . . . . . . .
Miquel Taron
Terapia génica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Noemí Regüart
Cuidados de enfermería en las nuevas modalidades terapéuticas . . . . . . . . . . . . . . . .
Ana Jiménez
Avances en el manejo multimodal del cáncer de pulmón no microcítico . . . . . . . . . . .
Pilar Garrido
Actualización del tratamiento de cáncer de pulmón . . . . . . . . . . . . . . . . . . . . . . . . .
José Miguel Sánchez
Índice
.
13
.
15
.
23
.
39
.
45
.
51
.
71
.
81
.
83
.
89
.
111
.
129
.
135
.
155
.
157
.
195
.
205
.
213
.
231
.
247
5
Introducción
En primer lugar les damos nuestra más cordial bienvenida a este segundo curso de la Escuela
Europea de Oncología (ESO) en el CNIO sobre cáncer de pulmón. El primero, que versó sobre cáncer
de mama, se celebró en octubre de 2003.
El cáncer de pulmón es la primera causa de muerte por cáncer en los países occidentales. El factor
etiológico responsable de la mayor parte de los casos es el tabaco. Durante este curso, además del
efecto de los carcinógenos del tabaco se tratará de los genes alterados en los tumores pulmonares así
como de otras anormalidades moleculares que tienen lugar durante el desarrollo de este tipo de cáncer.
El pronóstico de los pacientes con cáncer de pulmón depende claramente del estadio tumoral en que
se diagnostica la enfermedad. Varios estudios han demostrado que es posible detectar alteraciones
genéticas y moleculares en lavados broncoalveolares de pacientes con cáncer de pulmón y se están
llevando a cabo trabajos prospectivos que determinarán su posible uso en el diagnóstico precoz de
este tipo de cáncer. Otras investigaciones revelan factores moleculares relacionados con la respuesta a
la terapia, los patrones de toxicidad y el pronóstico del enfermo de cáncer de pulmón.
Como consecuencia de los estudios dedicados a la elucidación del conjunto de alteraciones genéticas
y de las vías moleculares que producen la formación de un tumor esperamos que se produzcan mejoras
en el tratamiento del cáncer en un futuro no muy lejano. Algunos de estos esfuerzos ya han dado sus
frutos con el diseño de drogas dirigidas a alteraciones genéticas concretas, como es el caso del fármaco
STI571 para el tratamiento de la Leucemia Mieloide Crónica.
Durante el curso se presentarán los fármacos que actualmente se están ensayando o se están desarrollando
para el tratamiento del cáncer de pulmón.
La contribución de cada ponente en esta publicación ha sido especificada en la por tadilla
correspondiente.
Esperamos sinceramente les sirva de referencia en el estudio de esta neoplasia.
Un saludo muy cordial,
Montserrat Sánchez-Céspedes
Jefe del Grupo de Cáncer de Pulmón
CNIO
Rafael Rosell
Jefe del Servicio de Oncología Médica
Institut Català d’Oncologia, Hospital Germans Trias i Pujol,
Introducción
7
PROGRAMA
Jueves 17 de febrero
15.00
Bienvenida
Miguel Ángel Piris
Sesión I:
Etiología y bases moleculares del cáncer de pulmón
Moderador: Ángel López-Encuentra
15.10
Epidemiología del cáncer de pulmón
José Franco
15.50
Factores de susceptibilidad al cáncer de pulmón
Juan Miguel Barros Dios
16.30
Carcinógenos y origen del cáncer de pulmón
Julián Carretero
17.10
Café
17.50
Alteraciones genético-moleculares en el cáncer de pulmón
Montserrat Sánchez-Céspedes
18.30
Telómeros y telomerasa en cáncer de pulmón
Jean Charles Soria
19.10
Lectura crítica de los artículos sobre factores etiológicos
del cáncer de pulmón
Esteve Fernández
Viernes 18 de febrero
Sesión II: Alteraciones genético-moleculares en cáncer de pulmón:
utilización clínica
Moderador: Rafael Rosell
09.00
Clasificación histológica y lesiones preneoplásicas en cáncer de pulmón
Josep Ramírez
09.40
Búsqueda de marcadores moleculares para la detección precoz
del cáncer de pulmón
Luis M. Montuenga
8
Cáncer de pulmón
10.20
Café
11.00
Factores pronósticos en cáncer de pulmón
Ángel López-Encuentra
11.40
Aplicación de las matrices de tejido ("tissue microarrays")
al estudio de los carcinomas de pulmón no microcíticos
Fernando López-Ríos
12.20
Metilación y cáncer de pulmón
Manel Esteller
13.00
Almuerzo
Sesión III: Perspectivas de las nuevas terapias en cáncer de pulmón
Moderador: Montserrat Sánchez-Céspedes
14.30
Dianas moleculares y nuevas terapias
Rafael Rosell
15.10
Factores de resistencia a quimioterapia en cáncer de pulmón
Miquel Taron
15.50
Café
16.20
Terapia génica
Noemí Regüart
17.00
Cuidados de enfermería en las nuevas modalidades terapéuticas
Ana Jiménez
17.40
Avances en el manejo multimodal del cáncer de pulmón no microcítico
Pilar Garrido
18.20
Actualización del tratamiento de cáncer de pulmón
José Miguel Sánchez
Programa
9
PONENTES
Juan Miguel Barros Dios (mrbarros@usc.es)
Universidad de Santiago de Compostela, Santiago de Compostela, ES
Julián Carretero (jcarretero@cnio.es)
Centro Nacional de Investigaciones Oncológicas, Madrid, ES
Manel Esteller (mesteller@cnio.es)
Centro Nacional de Investigaciones Oncológicas, Madrid, ES
Esteve Fernández (efernandez@iconcologia.catsalut.net)
Institut Català d'Oncologia y Universitat de Barcelona, Barcelona, ES
José Franco (franco_jos@gva.es)
Hospital Clínico Universitario, Valencia, ES
Pilar Garrido (pgarrido.hrc@salud.madrid.org)
Hospital Ramón y Cajal, Madrid, ES
Ana Jiménez (ajimenezarate@hotmail.com)
Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES
Ángel López-Encuentra (lencuent@h12o.es)
Hospital Universitario 12 de Octubre, Madrid, ES
Fernando López-Ríos (flopezrios.hdoc@salud.madrid.org)
Hospital Universitario 12 de Octubre, Madrid, ES
10
Cáncer de pulmón
Luis M. Montuenga (lmontuenga@unav.es)
Centro de Investigación Médica Aplicada, Universidad de Navarra, Pamplona, ES
Miguel Ángel Piris (mapiris@cnio.es)
Centro Nacional de Investigaciones Oncológicas, Madrid, ES
José Ramirez (JRAMIREZ@clinic.ub.es)
Hospital Clinic, Universitat de Barcelona, ES
Noemí Regüart (32497nra@comb.es)
Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES
Rafael Rosell (rrosell@ns.hugtip.scs.es)
Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES
José Miguel Sánchez (jmst@ns.hugtip.scs.es)
Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES
Montserrat Sánchez-Céspedes (msanchez@cnio.es)
Centro Nacional de Investigaciones Oncológicas, Madrid, ES
Jean-Charles Soria (soria@igr.fr)
Institut Gustave-Roussy, Paris, FR
Miquel Taron (mtaron@saludalia.com)
Institut Català d'Oncologia, Hospital Germans Trias i Pujol, Barcelona, ES
Ponentes
11
Sesión 1
ETIOLOGÍA Y BASES MOLECULARES
DEL CÁNCER DE PULMÓN
Moderador: Ángel López-Encuentra
EPIDEMIOLOGÍA
DEL CÁNCER DE PULMÓN
José Franco
Hospital Clínico Universitario,
Valencia
Contenido:
Resumen de la ponencia
Bibliografía
Artículo del ponente
Epidemiología del cáncer de pulmón
José Franco
Servicio de Neumología
Hospital Clínico Universitario, Valencia
l tabaco es la causa principal de cáncer de pulmón, siendo responsable de más del 90% de los
casos no sólo directamente sino indirectamente (tabaquismo pasivo) y en asociación con otras
sustancias. Existen otras causas (polución ambiental, laboral o en los hogares) y factores modificadores
del riesgo individual como la dieta o la susceptibilidad genética. Sin embargo, el consumo de cigarrillos
es el elemento que confiere el carácter de epidemia a la enfermedad. Además, debido a la clara relación
entre tabaco y cáncer de pulmón, se puede considerar al cáncer de pulmón como marcador del
tabaquismo de una población.
E
El hábito de fumar se ha iniciado en momentos diferentes y ha seguido patrones distintos según
las características culturales y socioeconómicas de cada país. En países como Estados Unidos o el Reino
Unido se adquirió tempranamente en el siglo XX, primero en varones y poco después en mujeres, y
comenzó a declinar en los años 60. En España sin embargo, se desarrolló tardíamente respecto a estos
países y las mujeres se incorporaron a fumar mucho después que los varones.
La supervivencia global del cáncer de pulmón es baja (sólo del 10-13% a los 5 años) y no ha
cambiado sustancialmente durante las últimas 2 décadas a pesar del desarrollo de tratamientos
multidisciplinarios en pacientes con estadios más avanzados de la enfermedad. Esto determina una
estrecha correlación entre incidencia y mortalidad, de manera que se puede estudiar la evolución de
la epidemia en una población dada a partir de los datos de mortalidad.
El hábito de fumar se establece generalmente a una edad temprana y tiende a seguir patrones
específicos para cada generación (hábito generacional). Además existe un largo período de latencia de
unos 30 años entre el establecimiento del hábito de fumar y el desarrollo de la enfermedad, que se
manifiesta de forma más temprana en los individuos más jóvenes y se extiende posteriormente a los
de mayor edad. Así, de la misma manera que los datos de mortalidad por cáncer de pulmón son un
indicador del hábito tabáquico de la población durante las décadas pasadas, también los cambios recientes
en el hábito de fumar junto con las tendencias de la mortalidad en las jóvenes generaciones permiten
predecir el curso de la epidemia en el futuro.
Según datos de la Encuesta Nacional de Salud, el consumo de tabaco en la población española
mayor de 16 años ha disminuido en hombres del 64% en 1978 al 42% en 2001 y ha aumentado en
mujeres del 17% en 1978 al 27,2% en 2001. Este diferente comportamiento respecto al tabaco según
el género se refleja también en las tasas de mortalidad por cáncer de pulmón. En hombres, la tasa
estandarizada para todas las edades se ha doblado en las últimas décadas (de 31,4 x 100.000 en 1973
a 64,2 en 2001). Sin embargo, en mujeres las tasas han permanecido bajas hasta recientemente (6,3
en 1973 y 6,4 en 1997) difiriendo apenas de lo esperado en una población nunca fumadora, pero en
los últimos años empieza a observarse un incremento significativo (7,6 en 2001). Respecto a las tasas
específicas por edad, en varones se observan incrementos en todos los grupos mayores de 35 años,
pero en los más jóvenes (30-34 años) la mortalidad ha disminuido desde 1988. En mujeres el patrón
es muy diferente: las tasas disminuyen en la mayoría de los grupos de edad hasta finales de la década
de los 80 y después aumentan significativamente en los grupos más jóvenes.
Debido al carácter generacional del hábito tabáquico, el estudio de la mortalidad mediante
modelos edad-periodo-cohorte constituye una aproximación más exacta a la evolución de la epidemia
Epidemiología del cáncer de pulmón
17
de cáncer de pulmón. Utilizando este método se puede observar que el efecto cohorte aumenta en
varones hasta las generaciones nacidas alrededor de 1952, y después la mortalidad disminuye ligeramente
en los más jóvenes. En mujeres, sin embargo, el efecto cohorte disminuye hasta las generaciones nacidas
en 1932 y aumenta de forma marcada a partir de 1942.
En resumen, sobre la base de las variaciones de la mortalidad en las jóvenes generaciones y los
datos sobre el consumo de tabaco se pueden esperar cambios de tendencia en la evolución de la
epidemia de cáncer de pulmón en España. Así, en mujeres, el incremento de mortalidad observado en
las más jóvenes señala el comienzo de la epidemia de cáncer de pulmón debido al continuo aumento
de la prevalencia de mujeres fumadoras. Por el contrario en hombres, considerando la leve disminución
de la mortalidad en los más jóvenes, es posible prever una evolución más favorable de la epidemia si
la prevalencia de tabaquismo sigue disminuyendo. Por último, la discreta pero significativa disminución
de la mortalidad observada en mujeres hasta finales de los años 80 podría estar relacionada con una
menor exposición al tabaquismo pasivo en casa como consecuencia de la disminución del número de
varones fumadores.
Bibliografía:
Bray F, Tyczynski JE, Parkin DM. Going up or coming down? The changing phases of the
lung cancer epidemic from 1967 to 1999 in the 15 European Union countries. Eur J Cancer. 2004 Jan;
40(1):96-125.
Franco J, Pérez-Hoyos S, Plaza P. Changes in lung-cancer mortality trends in Spain. Int J Cancer. 2002
Jan 1; 97(1):102-5.
18
Cáncer de pulmón
Publication of the International Union Against Cancer
Int. J. Cancer: 97, 102–105 (2002)
© 2002 Wiley-Liss, Inc.
CHANGES IN LUNG-CANCER MORTALITY TRENDS IN SPAIN
José FRANCO1*, Santiago PÉREZ-HOYOS2 and Pedro PLAZA3
Servicio de Neumologı́a, Hospital Clı́nico Universitario, Valencia, Spain
2
Escuela Valenciana de Estudios para la Salud, Valencia, Spain
3
Servicio de Neumologı́a, Hospital Universitario Dr. Peset, Valencia, Spain
1
Several changes in smoking patterns over the past decades
in Spain can be expected to result in a shift in lung-cancer
mortality rates. We examined time trends in lung-cancer
mortality from 1973–1997 using a log-linear Poisson ageperiod-cohort model. The standardized lung-cancer mortality rate for men almost doubled, from 31.4 per 100,000 in
1973 to 58.6 in 1997, with an average annual increase of 2.7%.
Mortality increased for male generations born until 1952 as a
consequence of the increasing cigarette smoking in successive birth cohorts. However, the slight downward trend observed for the 2 youngest generations suggests a more favorable outcome of the lung-cancer epidemic among Spanish
males in the coming years, if this trend continues. For
women, mortality rates were 5 to 9 times lower than those
for men, 6.3 per 100,000 in 1973 and 6.4 in 1997. However,
the increasing mortality among younger generations born
since 1942 reflects the rise in the prevalence of smoking
women during the last decades and can be expected to
spread to older age groups as a cohort effect, indicating the
early phase of the smoking-related lung-cancer epidemic
among Spanish females. The decreasing mortality trend observed in women until the late 1980s could be attributed to a
lower exposure to environmental tobacco smoke at home as
a result of a significant reduction in the prevalence of smoking men.
© 2002 Wiley-Liss, Inc.
Key words: lung-cancer mortality; Spain; smoking habits; age-period-cohort model; time trends
In Mediterranean countries and in Spain since 1990, malignant
tumors are the leading cause of death, whereas heart diseases are
placed second.1 Lung cancer is the most frequent fatal cancer
among men in Spain2 as well as in many other developed countries.
Because of the poor survival from lung cancer, there is a close
correlation between incidence and mortality. The overall 5-year
survival rate of 10 –13% has not changed over the past 2 decades,
though the implementation of multimodality therapy in locally
advanced disease has begun to modestly improve survival in
patients with more advanced stages of disease.3
Cigarette smoking plays a dominant role in lung-cancer causation, being responsible for up to 90% of the lung-cancer epidemic,
not only directly but indirectly (passive smoking) and in association with other substances such as asbestos and radon.4 Smoking
patterns have changed markedly and in different directions in
several countries over the past decades; therefore, time trends in
lung-cancer mortality differ between countries, cohorts and sexes.5
Several changes in smoking habits in Spain, such as a decline in
the prevalence of smoking among men and a rise among women,
can be expected to result in a shift in lung-cancer mortality trends.
Because tobacco smoking habits are generally established at an
early age and are characteristic for a given birth cohort,5 the
development of the lung-cancer epidemic can be analyzed most
accurately by studying age-specific rates by birth cohort.6
We analyzed trends in lung-cancer mortality in Spain from
1973–1997, using a Poisson log-linear age-period-cohort model.
MATERIAL AND METHODS
Population figures and data on deaths from lung cancer in Spain
during the period 1973–1997 were obtained from official publica-
tions of the Instituto Nacional de Estadı́stica (INE, National Institute of Statistics). The population was that estimated at 1 July of
each year by the INE based on official censuses. Deaths from lung
cancer corresponded to code 162 of the International Classification
of Diseases, Eighth and Ninth Revisions (ICD-8 and ICD-9).
From these data, age-specific death rates for 5 calendar periods
of 5 years each (1973–1977 to 1993–1997) and 9 age groups of 5
years each (30 –34 to 70 –74 years) were derived. Using this
classification of age and time, 13 overlapping birth cohorts of 10
years each were identified and defined according to the central year
of birth (1902/3 to 1962/3). Because death certification is less
reliable at elderly ages and problems arise from random variation
from small numbers at young ages, only the age groups between 30
and 74 years were considered.7
Age-standardized mortality rates were calculated for men and
women using the direct method with the Spanish population of
1980 as the reference.
The percent annual change in age-specific rates was calculated
from a regression equation after transforming the dependent variable (single calendar year rate) into natural logarithms, with the
year as the independent variable. The coefficient B (slope) in the
equation with a 95% confidence interval (CI) was considered the
mean annual percentage of variation.
Based on the matrix of lung-cancer deaths and population broken down by 5-year calendar period and age group, the effects of
age, period and cohort were calculated through a log-linear Poisson model fitted using the S-PLUS program (Insightful Corp.,
Seattle, WA) with the appropriate macro adapted from the Decarli
and La Vecchia8 GLIM macro. Estimates were derived from the
model, including the 3 factors that minimize the sum of the
Euclidean distances from the 3 possible 2-factor models: age
period (AP), age cohort (AC) and cohort period (CP). The procedure of minimization is based on the least squares weighted on the
inverse of the log-likelihood of each 2-factor model.7
Log-likelihood ratio statistics (deviance) were used to test the
goodness of fit, while the difference between 2 models was tested
by comparing the change in the deviance with the degrees of
freedom. This test, however, often indicates lack of fit in population-based data even when the model appears qualitatively to
describe the data well since the number of events (deaths) is often
large, so even small departures from the model are detected.9
Assuming no period or cohort slope, the average of the period
values was fixed at unity, as was the average of the cohort values;
thus, age values were of the same order of magnitude as agespecific rates.7
Because age, period and birth cohort variables are arithmetically
interrelated, knowing 2 of them fixes the third, implying that the
chosen solution is not unique,10 a problem known as nonidentifi*Correspondence to: Servicio de Neumologı́a, Hospital Clı́nico Universitario, Avda. Vicente Blasco Ibáñez 17, 46010 Valencia, Spain.
Fax: ⫹34-96 3862657. E-mail: jfs01v@nacom.es
Received 4 July 2000; Revised 17 April, 19 July 2001; Accepted 30 July
2001
LUNG-CANCER MORTALITY IN SPAIN
103
FIGURE 1 – Age-standardized lung-cancer mortality rates for men
and women in Spain, from 1973–1997.
TABLE I – GOODNESS OF FIT FOR AND COMPARISONS BETWEEN
DIFFERENT AGE, PERIOD AND COHORT POISSON REGRESSION MODELS
OF LUNG-CANCER MORTALITY FOR MALES IN SPAIN
Model
Age (A)
Age-period (AP)
Age-cohort (AC)
Age-period-cohort
(APC)
Residual
Change
Deviance
d.f.
Deviance
d.f.
p
6,031.9
36
390.4
437.9
70.4
32
24
21
5,641.5
5,594.0
320.0
367.5
4
12
11
3
⬍0.0011
⬍0.0012
⬍0.0013
⬍0.0014
FIGURE 2 – Age-specific lung-cancer mortality rates by 5-year age
intervals and birth cohort for Spanish males.
1
A vs. AP.–2A vs. AC.–3AP vs. APC.–4AC vs. APC. d.f., degrees of
freedom.
TABLE II – GOODNESS OF FIT FOR AND COMPARISONS BETWEEN
DIFFERENT AGE, PERIOD AND COHORT POISSON REGRESSION MODELS
OF LUNG-CANCER MORTALITY FOR FEMALES IN SPAIN
Model
Residual
Change
Deviance
d.f.
Deviance
d.f.
p
Age (A)
187.7
36
Age-period (AP)
Age-cohort (AC)
Age-period-cohort
(APC)
118.3
70.6
26.7
32
24
21
69.4
117.1
91.6
43.9
4
12
11
3
⬍0.0011
⬍0.0012
⬍0.0013
⬍0.0014
1
A vs. AP.–2A vs. AC.–3AP vs. APC.–4AC vs. APC. d.f., degrees of
freedom.
ability of parameters. Moreover, when the majority of age-specific
rates are in the same direction, both cohort-of-birth and period-ofdeath patterns are similar and it is difficult to establish whether the
major underlying trend is a cohort or period effect. Consequently,
the results of the model should be chiefly viewed as a guide toward
summarizing overall tendencies, and age-specific rates should be
considered before any conclusions are drawn.7
RESULTS
The standardized lung-cancer mortality rate for men almost
doubled over the study period, from 31.4 per 100,000 in 1973 to
58.6 in 1997, with an average annual increase of 2.7% (95% CI
2.4 –3.0). For women, mortality rates were 5 to 9 times lower than
that for men (Fig. 1), 6.3 and 6.4 per 100,000 in 1973 and 1997,
respectively; there was a slight annual decrease of – 0.7% (95% CI
FIGURE 3 – Results of age, period and cohort modeling for Spanish
men. Age values are expressed as rates per 100,000 population. Period-of-death and cohort-of-birth values are expressed in relative terms
against their weighted average set to unity.
–1.1 to – 0.3) until 1988 and then an increase of 1.5% (95% CI
1.1–1.9) annually.
Age-specific trends in lung-cancer mortality rates for men
showed a statistically significant annual increase over the whole
study period in all groups aged 35 years and over, ranging from
2.1% (95% CI 1.8 –2.4) annually for the age group 65 to 69 years
to 4.5% (95% CI 3.7–5.2) for the age group 40 to 44 years. In the
youngest group (30 –34 years), rates increased until 1988, with an
opposite trend thereafter of –5.4% (95% CI –10.1 to – 0.7) annually.
For women, the patterns were quite different: age-specific mortality rates showed a statistically significant decrease over the
whole study period in groups aged 55 years and over, ranging from
– 0.5% (95% CI – 0.1 to – 0.9) annually among 70- to 74-year-olds
to –1.0% (95% CI – 0.3 to –1.6) among 55- to 59-year-olds; this
decline was also observed until 1984 for groups aged 35 to 54
years. However, since 1984, rates have increased significantly in
younger groups (30 – 49 years), ranging from 3.9% (95% CI 1.6 –
6.1) annually in 45- to 49-year-olds to 7.9% (95% CI 3.6 –12.1) in
35- to 39-year-olds.
Tables I and II show the goodness of fit (scaled deviances) for
the age-period-cohort models and comparisons between models.
Mortality trends for both genders were better explained by the full
104
FRANCO ET AL.
FIGURE 6 – Prevalence of smoking among men and women aged 16
years and above in Spain, from 1978 –1997.
FIGURE 4 – Age-specific lung-cancer mortality rates by 5-year age
intervals and birth cohort for Spanish females.
FIGURE 5 – Results of age, period and cohort modeling for Spanish
women. Age values are expressed as rates per 100,000 population.
Period-of-death and cohort-of-birth values are expressed in relative
terms against their weighted average set to unity.
age ⫹ period ⫹ cohort (APC) model, though the APC model fit
mortality data only for women (deviance ⫽ 26.7 on 21 degrees of
freedom, p ⫽ 0.18). For men, deviances were greater than those
for women and the APC model did not fit, probably due to the
large number of deaths, though overdispersion could exist. One
must be cautious with the interpretation of the multiplicative age,
period and cohort effects resulting from the modeling. Both period
and cohort effects were statistically significant for men and women
when the APC model was compared with the AC or AP submodel.
As expected, mortality increased with age in both sexes. For men
(Figs. 2, 3), the cohort effect was steadily upward to the cohort
born around 1952, with a slight reversal downward for the 2
youngest generations; also, a rising period effect was observed up
to 1992. For women (Figs. 4,5), cohort values decreased moderately until the cohort born around 1932, then leveled off and
increased for young women born since 1942; moreover, there was
evidence of a period effect downward until 1987 and upward
thereafter.
DISCUSSION
Recent changes in mortality from lung cancer are mainly related
to changes in smoking patterns over the past decades.11 Unfortu-
nately, in Spain, question-based studies on the general public’s
tobacco consumption are available only since 1978. Rates observed in young adults should reflect recent carcinogenic exposure
and can be expected to spread to older age groups in future years12
because smoking habits tend to be a characteristic of particular
generations. Our analysis of lung-cancer mortality in Spain shows
different trends for men and women.
In men, mortality increased for generations born up to 1952 as
a consequence of the increasing cigarette smoking in successive
birth cohorts. However, the decrease in the prevalence of smoking
men (Fig. 6) from 64% in 1978 to 45% in 199713,14 and the slight
decrease in mortality for the youngest cohorts observed in our
study suggest a more favorable outcome of the lung-cancer epidemic among Spanish males in the coming years, though major
efforts to discourage tobacco use should be made so that the
decreasing trend in the number of smoking men continues.
The relative risk of lung cancer decreases following smoking
cessation,15 and the impact of the decline in cigarette smoking on
lung-cancer mortality would be expected to show up first in the
younger groups as a cohort effect. The downturn in cigarette
consumption since the 1960s combined with lower tar content of
cigarettes was a clear precursor to the decline in lung-cancer
mortality rates in the United States and the United Kingdom.6
According to data from Tabacalera, a state owned company that
monopolized the tobacco market in Spain until 1998, the continuous increase in cigarette sales began to decline in the early 1990s,
with a decrease of 17.1% from 2,685.5 cigarettes per adult aged 15
years and older in 1991 to 2,226.2 in 1996.16,17 However, sales of
black tobacco, which has been related to a higher risk of lung
cancer in case-control studies,18 decreased over the last decades,
falling from 94% of total sales in 1961 to 31.3% in 1996, being
replaced by Virginia tobacco.
The low lung-cancer mortality rate observed among Spanish
women differs hardly at all from what might be expected if none
had ever smoked, suggesting that few of their lung-cancer deaths
are still due to smoking.19 However, the increasing mortality
among younger generations born since 1942 reflects the rise in
tobacco consumption among females during the last decades and
can be expected to spread to older age groups in the coming years
as a cohort effect. The increasing prevalence of smoking women
(Fig. 6) by 58.8%, from 17% in 1978 to 27% in 1997,13,14 and the
upward mortality trend in young adult life indicate the early phase
of the smoking-related lung-cancer epidemic among females. The
later onset of the epidemic in Spain compared with other developed countries can be attributed to smoking having become widespread among women only in the last few decades as well as to the
105
LUNG-CANCER MORTALITY IN SPAIN
latency period between the onset of exposure and the development
of disease.
The small but statistically significant decrease of mortality observed in Spanish women until 1988 is difficult to explain.5 Although caution is warranted in making inferences on the basis of
statistical modeling,20 the age-period-cohort analysis shows a cohort effect for generations born up to 1932, aside from the decrease
in mortality with the period of death up to 1987. In addition,
age-specific rates decreased continuously for women aged 55 years
and over and until the mid-1980s for younger women.
In countries with a female population that smokes relatively
rarely and a high male smoking prevalence, the risk and population
burden of lung cancer due to environmental tobacco smoke (ETS)
are considered relatively important.21 Therefore, because of the
reduction in the prevalence of smoking men in Spain, we can
hypothesize that the decreasing mortality trend observed in women
might be related to changes in exposure to ETS at home, though
we cannot exclude a role of other modifiable risk factors, such as
domestic radon, dietary factors, occupational carcinogens and air
contamination. Exposure to ETS from a spouse is a risk factor for
lung cancer among nonsmoking women, and the risk increases
consistently with increasing levels of exposure.22 In Spain, for
some decades, while smoking was rare among women, a great
number of nonsmoking wives would have been exposed to ETS
from their husbands’ smoking.
Changes in the prevalence of risk factors usually alter the
pattern of risk seen among birth cohorts; however, a substantial
decrease in a relatively common carcinogenic exposure could
cause a calendar-period decrease in risk after a sufficient latency
period. The effect of reducing tobacco carcinogen exposure on the
late stage of the carcinogenic process will be seen soon after the
change in exposure.20 The risk of lung cancer decreases with time
since cessation of ETS exposure, and there is no detectable risk
after a 15-year period.23 Therefore, once a significant number of
smoking men quit, the reduction in risk for wives decreases as a
cohort effect and, by affecting all age groups simultaneously, can
be manifest also as a period effect. Thus, the decreasing lungcancer mortality trend observed among Spanish women until the
late 1980s could be attributed to a lower exposure to ETS at home
as a result of a significant reduction in the prevalence of smoking
men.
The quality of official data on mortality can be affected in
different ways. Changes in the international death classification
rules or inaccuracy in certification may lead to variation in mortality statistics. Two ICD revisions came into force in Spain during
the study period; but code 162, assigned to malignant tumors of the
trachea, bronchus and lung, remains unchanged for both ICD-8
and ICD-9 revisions. Previous studies on the quality of death
certificates in Spain have shown reliable data on the cause of death
with regard to malignant tumors.24,25
In summary, on the basis of the variations observed among
younger generations, changes in the epidemiologic trends of lungcancer mortality rates can be expected in Spain. The upward trend
observed in younger women shows the beginning of the smokingrelated lung-cancer epidemic due to the continuous increase in the
prevalence of smoking women. Conversely, considering the decreasing tobacco consumption among men and the decline in
mortality observed in the youngest, an opposite downward trend
can be expected if the prevalence of smoking men continues to
diminish. The decrease in mortality observed for women until the
late 1980s could be related to a lower spousal ETS exposure.
ACKNOWLEDGEMENTS
We thank Dr. V. Moreno from Institut Català d’Oncologia for
providing the S-PLUS macro.
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Alonso I, Regidor E, Rodrı́guez C, et al. Principales causas de muerte
en España, 1992. Med Clin (Barc) 1996;107:441–5.
Fernández E, Borrás JM, Levi F, et al. Mortalidad por cáncer en
España, 1955–1994. Med Clin (Barc) 2000;114:449 –51.
Reif MS, Socinski MA, Rivera MP. Evidence-based medicine in the
treatment of non-small-cell lung cancer. Clin Chest Med 2000;1:107–
20.
Yesner R. Pathogenesis and pathology. Clin Chest Med 1993;1:17–
30.
Coleman MP, Esteve J, Damiecki P, et al. Trends in cancer incidence
and mortality. IARC Sci Publ 121. Lyon: IARC, 1993.
Kubik AK, Parkin DM, Plesko I, et al. Patterns of cigarette sales and
lung cancer mortality in some central and eastern European countries,
1960 –1989. Cancer 1995;75:2452– 60.
La Vecchia C, Negri E, Levi F, et al. Cancer mortality in Europe:
effects of age, cohort of birth and period of death. Eur J Cancer
1998;34:118 – 41.
Decarli A, La Vecchia C. Age, period and cohort models: review of
knowledge and implementation in GLIM. Riv Stat Appl 1987;20:32–
46.
Moolgavkar SH, Lee JAH, Stevens RG. Analysis of vital statistics
data. In: Rothman KJ, Greenland S. Modern epidemiology. New
York: Raven Press, 1998. 481–97.
Osmond C. Using age, period and cohort models to estimate future
mortality rates. Int J Epidemiol 1985;14:124 –9.
Bailar JC, Gornik HL. Cancer undefeated. N Engl J Med 1997;336:
1569 –74.
Doll R. Progress against cancer: an epidemiologic assessment. Am J
Epidemiol 1991;134:675– 88.
Regidor E, Rodrı́guez C, Gutiérrez-Fisac JL. Indicadores de Salud.
Tercera evaluación en España del programa regional europeo Salud
para todos. Madrid: Ministerio de Sanidad y Consumo, 1995.
14. Ministerio de Sanidad y Consumo. Encuesta Nacional de Salud de
España 1997. Madrid: Ministerio de Sanidad y Consumo, 1999.
15. Halpern MT, Gillespie BW, Warner KE. Patterns of absolute risk of
lung cancer mortality in former smokers. J Natl Cancer Inst 1993;85:
457– 64.
16. Tabacalera SA. Series históricas de consumo de tabaco elaborado,
1957–1991. Madrid: Tabacalera SA, 1992.
17. Tabacalera SA. Memoria de actividades, 1992–1996. Madrid: Tabacalera SA, 1997.
18. Armadans-Gil I, Vaqué-Rafart J, Rosselló J, et al. Cigarette smoking
and male lung cancer risk with special regard to type of tobacco. Int
J Epidemiol 1999;28,614 –9.
19. Peto R, López AD, Boreham J, et al. Mortality from tobacco in
developed countries: indirect estimation from national vital statistics.
Lancet 1992;339:1268 –78.
20. Jemal A, Chu KC, Tarone RE. Recent trends in lung cancer mortality
in the United States. J Natl Cancer Inst 2001;93:277– 83.
21. Lee CH, Ko YC, Coggins W, et al. Lifetime environmental exposure
to tobacco smoke and primary lung cancer of non-smoking Taiwanese
women. Int J Epidemiol 2000;29:224 –31.
22. Zhong L, Goldberg MS, Parent ME, et al. Exposure to environmental
tobacco smoke and the risk of lung cancer: a meta-analysis. Lung
Cancer 2000;27:3–18.
23. Boffetta P, Agudo A, Ahrens W, et al. Multicenter case-control study
of exposure to environmental tobacco smoke and lung cancer in
Europe. J Natl Cancer Inst 1998;90:1440 –50.
24. Benavides FG, Bolumar F, Peris R. Quality of death certificates in
Valencia, Spain. Am J Public Health 1989;79:1352– 4.
25. Pañella H, Borrell C, Rodrı́guez C, et al. Validación de la causa
básica de defunción en Barcelona, 1985. Med Clin (Barc) 1989;
92:129 –34.
FACTORES DE SUSCEPTIBILIDAD
AL CÁNCER DE PULMÓN
Juan Miguel Barros Dios
Universidad de Santiago de Compostela
Santiago de Compostela
Contenido:
Resumen de la ponencia
Publicaciones del grupo de investigación
Bibliografía
Se presenta una breve revisión, desde el punto de vista epidemiológico, del uso de biomarcadores
de susceptibilidad del cáncer de pulmón, definiéndolos y diferenciándolos del resto (exposición y
efecto) completada con esquemas del papel jugado por los mismos en el metabolismo de las diferentes
sustancias xenobióticas y el posible papel modulador de determinados polimorfismos de genes,
principalmente de Fase I y Fase II. Se acompaña de una extensa bibliografía.
Biomarcadores epidemiológicos
del cáncer de pulmón
Alberto Ruano-Raviña / Juan M. Barros Dios
Área de Medicina Preventiva e Saúde Pública
Universidade de Santiago de Compostela
TIPOS DE BIOMARCADORES
Los marcadores biológicos se clasifican habitualmente en tres grandes familias: marcadores de exposición,
marcadores de efecto o de respuesta y marcadores de susceptibilidad. Otra clasificación distingue
marcadores de dosis interna, marcadores de dosis biológicamente efectiva, marcadores de efecto biológico
y marcadores de susceptibilidad. Ambas clasificaciones son equivalentes salvo pequeños matices.
Marcadores de exposición
En esta clasificación entrarían los marcadores de dosis interna y de dosis biológicamente efectiva. Un
marcador de exposición puede ser un compuesto xenobiótico, un metabolito de ese compuesto dentro
del cuerpo u otro suceso relacionado con la exposición. Los marcadores de exposición deben ser
medidos en muestras apropiadas, como la sangre, suero u orina. Llamamos muestras apropiadas a
aquellas que sean de fácil acceso y conservación para su posible uso posterior. Fácil acceso implica poca
complejidad técnica para su obtención, que se puedan obtener en cualquier momento y que causen
pocas molestias para el sujeto.
Como ejemplos típicos de marcadores de dosis interna tenemos:
• PCBs (bifenilos policlorados) en el tejido adiposo procedentes de la contaminación ambiental
• Cotinina en plasma o en saliva procedente del tabaco.
• Derivados N-nitrosos en orina originados por el tabaco o la dieta. Estos dosímetros internos
tienen la ventaja de ser relativamente fáciles de vigilar y demuestran que la exposición ha
derivado en la bioactivación de carcinógenos.
Los marcadores de dosis biológicamente efectiva reflejan la cantidad de carcinógeno que ha
interactuado con macromoléculas celulares (DNA, RNA o proteínas). Este tipo de marcadores es más
relevante para la carcinogénesis que los de dosis interna, pero poseen más problemas analíticos. Los
aductos de DNA y proteínas pertenecen a este grupo.
Antes de proseguir hay que matizar los conceptos de dosis y de exposición. La dosis es la
cantidad de sustancia depositada en el cuerpo en un momento dado y la exposición es cualquier
condición que proporciona a un agente externo una oportunidad para actuar en el organismo. Por lo
tanto, de la misma exposición pueden resultar dosis significativamente diferentes. Las diferencias en las
Factores de susceptibilidad al cáncer de pulmón
25
dosis se ven influenciadas por la variabilidad fisiológica entre los individuos, debido a la absorción,
distribución o metabolización. Una misma exposición no es igual a una misma dosis.
El marcador ideal de exposición debería reunir las siguientes características:
a) La recogida de la muestra y su análisis deben ser simples y reproducibles.
b) El marcador debe ser específico para un tipo particular de exposición y tener una clara relación
con el grado de exposición.
c) El marcador sólo debe reflejar un cambio subclínico y reversible.
d) Podrán considerarse intervenciones u otras medidas preventivas si así lo indica el resultado
del biomarcador.
e) Su uso debe ser éticamente aceptable.
Un ejemplo en el que se usan marcadores de exposición es el de los estudios transversales para
determinar si los compuestos químicos en el ambiente o en la dieta son realmente absorbidos, ayudando
así a establecer la plausibilidad biológica de las asociaciones exposición-enfermedad descritas en
investigaciones anteriores. Esta utilidad ha jugado un importante papel al demostrar, por ejemplo, que
los compuestos presentes en el humo del tabaco pueden ser detectados en personas no fumadoras
expuestas al humo de otros individuos.
Validez de los BM de exposición
Algunos BM miden factores que son fijos y que no varían con el tiempo en las personas, por ejemplo
los genes de susceptibilidad que pueden interaccionar con factores xenobióticos en el origen del cáncer.
Otros BM miden parámetros que cambian con el tiempo (por ejemplo, los niveles de micronutrientes
varían de día a día). En los estudios epidemiológicos es importante que la principal exposición bajo
estudio sea analizada de un modo tiempo-dependiente, teniendo en cuenta una posible inducción y
períodos de latencia, y una relativa importancia etiológica de la intensidad de la exposición, la duración
de la exposición y la exposición acumulada. La aproximación más simple es analizar la exposición
acumulada de un modo tiempo-dependiente. Esto sería suficiente cuando el objetivo es simplemente
considerar si hay o no un efecto de la exposición.
Muchos BM actualmente disponibles sólo indican exposiciones relativamente recientes. Por ejemplo,
los niveles séricos de micronutrientes reflejan una ingesta reciente más que lejana. Debido al largo
período de inducción de muchos cánceres, las exposiciones de hace 10-30 años son las etiológicamente
relevantes. Esta es una importante limitación en los estudios de cohortes y casos y controles que buscan
medir los efectos de las exposiciones históricas. Algunos BM son mejores que otros en este aspecto,
pero incluso los mejores BM de exposición química reflejan sólo las ultimas semanas o meses de
exposición. Por otro lado, con algunos BM (niveles séricos de TCDD) puede ser posible estimar
exposiciones pasadas si el período de exposición es conocido, si la vida media es relativamente larga
(y es conocida) y si se asume que no ha habido exposiciones significativas recientemente o si se sabe
que los niveles de exposición han permanecido constantes en el tiempo.
Marcadores de efecto
Un marcador de efecto puede ser un compuesto endógeno, una medida de la capacidad funcional
(volumen de aire inspirado) u otro indicador del estado o equilibrio del cuerpo o de un órgano que
esté afectado por la exposición. Los marcadores de efecto suelen ser indicadores preclínicos de
alteraciones. Estos marcadores pueden ser específicos o no específicos. Los específicos indican un efecto
26
Cáncer de pulmón
biológico de una exposición particular, proporcionando una evidencia que puede ser usada con propósitos
preventivos. Los no específicos no señalan ninguna causa en particular del efecto, indican el efecto total
e integrado que podría deberse a una exposición múltiple.
Algunos autores clasifican los marcadores de efecto como marcadores de estructura alterada y
marcadores de función alterada (como, por ejemplo, alteraciones fisiológicas en el intercambio gaseoso).
Entre los marcadores de efecto se encuentran las aberraciones cromosómicas, intercambios de
cromátidas hermanas (Sister Chromatide Exchanges), la aparición de micronúcleos y las alteraciones en
oncogenes o genes supresores de tumores, que se verán más adelante. Se podrían incluir en este
apartado los marcadores tumorales, que se utilizan para el diagnóstico del cáncer.
Marcadores de susceptibilidad
Un marcador de susceptibilidad, heredado o inducido, es un indicador de que el individuo es
particularmente sensible al efecto de un agente xenobiótico o a los efectos de un grupo de estos
compuestos. El interés de este tipo de marcadores reside en la pregunta: ¿por qué, para un nivel dado
de exposición a un carcinógeno, sólo una proporción de los individuos expuestos desarrolla cáncer? Es
decir, ¿por qué personas con una misma exposición aparente tienen un riesgo diferente de enfermedad?
Para otros autores, los marcadores de susceptibilidad sólo son indicadores estadísticos cuyo valor
predictivo depende de la frecuencia con la cual aquellos individuos con ese marcador desarrollen la
alteración esperada. La susceptibilidad puede ser absoluta o parcial. Por ejemplo, si la susceptibilidad es
debida a un enzima, éste puede presentarse en unas cantidades menores de las normales (parcial), estar
ausente en el individuo (absoluta) o aparecer con una estructura diferente debido a alteraciones en el
DNA, implicando la pérdida de su función (absoluta). Podemos decir que una susceptibilidad es genética
si las diferencias se localizan a nivel del DNA. Se han propuesto diferentes subáreas para la susceptibilidad
genética: a) variaciones heredadas en los enzimas que metabolizan carcinógenos, b) mutaciones en líneas
celulares (germline) de genes asociados a tumores y, c) diferencias heredadas en la formación de aductos
de DNA y en sus mecanismos de reparación. Los individuos con predisposición hereditaria al cáncer
son portadores de una mutación en alguno de los genes críticos en el control de los procesos de
crecimiento y división celular. Esta mutación, en sí misma no es suficiente para el desarrollo de un tumor,
ya que requiere la acumulación adicional de alteraciones sobre otros genes críticos. Por ello, puede
afirmarse que las mutaciones heredadas sólo confieren una mayor susceptibilidad para desarrollar cáncer,
ya que necesitan de menos alteraciones adicionales que la población general para sufrir una transformación
maligna, lo que justifica la tendencia al desarrollo del cáncer en etapas más tempranas de la vida.
Efectos sobre el riesgo de los marcadores de susceptibilidad
E
N
F
E
R
M
O
S
Mayor
Efecto umbral fisiológico
Riesgo de enfermedad
Individuos susceptibles
S
A
N
O
S
Menor
Individuos normales
Factores de susceptibilidad al cáncer de pulmón
27
El estudio de la interacción entre la dotación genética y el ambiente puede aumentar nuestra
capacidad de caracterizar riesgos relativamente bajos en la población. Además, estos estudios proporcionan
una aproximación a los mecanismos de la carcinogénesis, que pueden contribuir a establecer la plausibilidad
biológica de una asociación entre exposición y cáncer.
Conocer la intensidad con la que la susceptibilidad genética contribuye al riesgo de un individuo
de padecer cáncer (lo que se denomina penetrancia), es particularmente importante en situaciones
profesionales donde, con pocas excepciones, la exposición a sustancias químicas nocivas se desea reducir
a niveles que proporcionen un “riesgo aceptable”.
La epidemiología molecular ha introducido la posibilidad de estudiar los polimorfismos en el DNA,
los cuales son responsables de una parte de la susceptibilidad genética a los carcinógenos. Variaciones
habituales (ocurren en una frecuencia mayor del 1%) en la secuencia genética que pueden acabar en
una proteína alterada se denominan polimorfismos. Muchos polimorfismos no son funcionales, es decir,
no tienen fenotipo. Sin embargo, otros pueden dar origen a proteínas estructuralmente diferentes, lo
que provoca un impacto en la actividad enzimática. Como se ha podido determinar el locus genético
de muchos enzimas, se ha hecho posible la identificación de polimorfismos y la capacidad de distinguir
diferencias genotípicas y fenotípicas en la población. El conocimiento del exceso de riesgo (susceptibilidad)
en una población puede utilizarse para excluir individuos de un estudio, pues podrían alterar los resultados.
Ejemplos de marcadores de susceptibilidad del individuo
1. Variación metabólica: adquirida o heredada
Ejemplos: CYP1A1a, GSTM1b, NAT2c, colinesterasas
2. Estado nutricional
Ejemplos: β-caroteno, selenio, retinoides
3. Factores inmunogenéticos
Ejemplos: polimorfismos del MHCd de clase I y clase II
Fuente: elaboración propia
a: Gen de la familia del citocromo P450.
b: Glutation S-transferasa mu 1
c: N-acetil-transferasa 2
d: Complejo principal de histocompatibilidad
Los diseños de casos y controles son muy eficientes para examinar la interacción entre los
marcadores de susceptibilidad genética y las exposiciones ambientales, particularmente cuando disponemos
de datos de alta calidad sobre la exposición procedentes de cuestionarios o de vigilancia ambiental.
Las mejoras en el diseño de los estudios y en el ajuste de la estratificación de la población
combinando el uso de entrevistas y marcadores genéticos conduce a una nueva era en los estudios
de casos y controles al dotarlos de una potencia mucho mayor. Los factores genéticos no cambian con
el tiempo, no están afectados por el status de la enfermedad y son fáciles de medir retrospectivamente
comparados con los factores de riesgo ambientales. Los estudios de casos y controles son capaces de
estimar el riesgo de enfermedad en la población, ya que dan una información detallada sobre la presencia
o ausencia de un gen de susceptibilidad y permiten definir la magnitud de los riesgos y de la interacción
gen-ambiente, un paso crucial en la prevención de la enfermedad y en la promoción de la salud.
28
Cáncer de pulmón
Limitaciones
Con el uso de los biomarcadores surgen problemas de tipo ético o legal, originados por la determinación
de marcadores de susceptibilidad. Entre ellos está la posibilidad de que el genotipaje sea aplicado
prenatalmente, donde se podría ofrecer el aborto a los padres que hayan concebido un feto afectado.
Cuando la profilaxis o el tratamiento de esa susceptibilidad no pueden ser aplicados y el aborto es
rechazado, se podría argumentar que el conocimiento es más malo que bueno y podría generar una
grave carga psicológica en la persona afectada y/o su familia.
Por ahora es difícil sopesar la contribución de un polimorfismo particular al riesgo total de
enfermedad y sobre todo explicárselo a la población general. Un polimorfismo metabólico puede
proteger frente a un compuesto químico pero aumentar el riesgo de cáncer para otro. Puede aumentar
el riesgo de cáncer para un órgano pero proteger otro. Por esto es muy arriesgado generalizar para
todo el organismo las conclusiones obtenidas en el estudio concreto de un solo tipo de cáncer. Los
polimorfismos de dos o más enzimas diferentes en la misma persona pueden interactuar. En el supuesto
de que estos aspectos se conozcan y se haga posible la identificación de genes que confieran susceptibilidad
o resistencia a los cánceres inducidos por agentes exógenos (como las radiaciones ionizantes o los
compuestos químicos de las industrias), ¿hasta qué punto podría ser usada esta información? ¿Podrían
los empresarios de industrias químicas exigir que todos los potenciales empleados proporcionasen sus
genotipos a la hora de darles un puesto de trabajo? ¿Sería ético poner individuos con genotipos
“resistentes” en áreas de elevada exposición o denegar el empleo a personas con perfiles genéticos de
alto riesgo? ¿Sería posible bajar los estándares de higiene industrial al emplear una fuerza de trabajo
resistente?
Además de la limitación de obtener el consentimiento informado de los sujetos, también surge
la complicación de poder utilizar esas muestras para otros fines diferentes del original. Los investigadores
tienen la responsabilidad de interpretar correctamente los resultados de los estudios de biomarcadores.
Esto se debe a que la información obtenida puede ser usada de forma indebida o tener un efecto no
deseado en los sujetos del estudio.
Para muchos casos de cáncer, las exposiciones ocurridas hace 10-30 años son etiológicamente
relevantes. Incluso los mejores marcadores de exposición química reflejan sólo las últimas semanas o
meses de exposición. Otra dificultad es que no siempre está claro si estamos midiendo la exposición,
el efecto biológico o alguna etapa del proceso patológico.
Otro problema es que, en ausencia de enfermedad (o con ella), los individuos se resisten a
someterse a una toma de muestras invasiva (biopsias, aspirados). El uso de esas muestras hace esencial
para el desarrollo de la epidemiología molecular la colaboración eficaz de diversos especialistas, como
por ejemplo químicos analíticos, bioquímicos, biólogos moleculares, anatomo-patólogos, etc.
Aunque los ensayos de laboratorio generalmente se van mejorando con el tiempo, es casi inevitable
algún grado de mala clasificación (misclassification), especialmente durante la aplicación inicial del ensayo
a poblaciones humanas. Además, en las condiciones de campo comunes a la investigación epidemiológica,
hay factores externos al laboratorio que pueden aumentar la mala clasificación, como la variación en
el cumplimiento, por parte del sujeto, de protocolos fenotípicos y variaciones en la recolección de
muestras, procesado, tiempo de almacenamiento y condiciones de transporte. Las principales fuentes
de error para los ensayos fenotípicos metabólicos incluyen la exposición a medicamentos, ciertos
alimentos u otras exposiciones que inhiben o inducen la actividad enzimática y que podrían provocar
que los individuos que fuesen metabolizadores rápidos se clasificasen como lentos, y viceversa. También
puede haber una mala clasificación del genotipaje por algún fallo al reconocer una variante que contribuye
Factores de susceptibilidad al cáncer de pulmón
29
al genotipo de interés o por el empleo de un cebador erróneo cuando se hace una PCR (polymerase
chain reaction). Finalmente, errores de codificación en cualquier momento durante la recogida de la
muestra, el análisis en el laboratorio o en el procesado de los datos son casi inevitables y acumulables
en los resultados.
Por otra parte, existe también la dificultad de la validación. Hasta ahora, al ser un campo de
investigación que ha surgido hace poco tiempo no está muy claro si algunos biomarcadores reflejan
realmente lo que queremos medir. La validación de los biomarcadores implica la identificación sistemática
de los factores que influyen en la capacidad del marcador para predecir la exposición o un suceso en
la población a estudio. El primer paso, la validación en el laboratorio, implica averiguar factores tales
como el perfil de la curva dosis-respuesta, la sensibilidad a dosis bajas, la especificidad de las exposiciones
y la reproducibilidad del ensayo. En el segundo paso, la validación epidemiológica, se evalúan la sensibilidad
y especificidad en la población, la variación inter e intraindividual en la respuesta del biomarcador, la
persistencia, el nivel base, el valor predicitivo positivo y la posibilidad de realización y su relevancia
biológica.
Validación necesaria de los biomarcadores en la epidemiología molecular
Laboratorio
Epidemiológica
Curva dosis-respuesta
Niveles base en población no expuesta
Reproducibilidad del ensayo
Variación intraindividual en el tiempo
– de un ensayo a otro
– día a día
– de un laboratorio a otro
Límite de detección (sensibilidad a dosis bajas)
Especificidad de la exposición
– sin alterar la exposición
– al finalizar la exposición
(persistencia/vida media)
Variación interindividual
– respuesta a una exposición dada
– persistencia del biomarcador
Niveles en el tejido sustituto frente al tejido
diana (en su caso)
Relevancia biológica para la enfermedad
Valor predicitvo positivo
Viabilidad
– cantidad y disponibilidad del tejido
– coste
– tiempo requerido para cada ensayo
Fuente: adaptado de Perera.
Otro aspecto de la validación comprende la contribución específica que un biomarcador puede
hacer a la epidemiología, por ejemplo el valor añadido que se gana con el uso del marcador. La mayoría
de los marcadores de dosis interna (exposición) tienen una vida media corta o son biológicamente
inestables, de manera que su uso en estudios epidemiológicos de cáncer es limitado. La estabilidad de
los marcadores debe ser elevada, de forma que el almacenamiento de material biológico durante años
sea válido y eficiente.
30
Cáncer de pulmón
La contribución adicional de los biomarcadores debe ser medida siguiendo los principios que se
aplican para evaluar la efectividad de un test diagnóstico. Si suponemos que queremos medir
adecuadamente el hábito tabáquico de una población, y que el valor predictivo positivo de un cuestionario
es 0,94: ¿cuál es la ganancia adicional conseguida con la medida de la cotinina-nicotina? De acuerdo con
los conceptos utilizados en epidemiología clínica, 0,94 es la probabilidad pre-test de que el individuo
fume y la medida de la nicotina-cotinina representa la probabilidad post-test. La contribución del
biomarcador puede ser, por lo tanto, estimada como la diferencia entre las dos probabilidades. Una
consecuencia de este razonamiento es que el empleo del marcador es mejor en situaciones intermedias,
por ejemplo, cuando la probabilidad a priori no es ni muy alta ni muy baja. En otras palabras, el uso
de un biomarcador es justificable cuando se reduce significativamente la incertidumbre.
Factores de susceptibilidad al cáncer de pulmón
31
Publicaciones sobre epidemiología
del cáncer de pulmón: factores de riesgo
Grupo de Investigación del Área de Medicna Preventiva e Saúde Pública.
Universidade de Santiago de Compostela
Juan M. Barros Dios
DARBY S, HILL D, AUVINEN A, BARROS-DIOS JM, et al.
RESIDENTIAL RADON AND LUNG CANCER: DETAILED RESULTS OF A COLLABORATIVE ANALYSIS OF
INDIVIDUAL DATA ON 7,148 SUBJECTS WITH LUNG CANCER AND 14,208 SUBJECTS WITHOUT LUNG
CANCER FROM 13 EPIDEMIOLOGICAL STUDIES IN EUROPE
SCANDINAVIAN JOURNAL OF WORK, ENVIRONMENT AND HEALTH (Aceptado para
publicar)
DARBY S, HILL D, AUVINEN A, BARROS-DIOS JM, BAYSSON H, BOCHICCHIO F, DEO H, FALK R,
FORASTIERE F, HAKAMA M, HEID I, KREIENBROCK L, KREUZER M, LAGARDE F, MÄKELÄINEN I,
MUIRHEAD C, OBERAIGNER W, PERSHAGEN G, RUANO-RAVINA A, RUOESTEENOJA E,
SCHAFFRATH ROSARIO A, TIRMARCHE M, TOMASECK L WHITLEY E, WICHMANN HE, DOLL R.
RADON IN HOMES AND LUNG CANCER RISK: COLLABORATIVE ANALYSIS OF INDIVIDUAL DATA FROM
13 EUROPEAN CASE-CONTROL STUDIES.
BRITHIS MEDICAL JOURNAL (Aceptado en edición normal) Versión on-line publicada el
21/12/2004.
RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.
TYPE OF WINE AND RISK OF LUNG CANCER: A CASE-CONTROL STUDY IN SPAIN.
THORAX 2004 (59): 981-85.
BARROS-DIOS JM, RUANO RAVIÑA A.
CÁNCER DE PULMÓN. FACTORES DE RIESGO.
INVESTIGACIÓN Y CIENCIA 2004 (37):31-33.
RUANO-RAVINA A, FIGUEIRAS A, MONTES-MARTÍNEZ A, BARROS-DIOS JM.
DOSE-RESPONSE RELATIONSHIP BETWEEN TOBACCO AND LUNG CANCER.
EUROPEAN JOURNAL OF CANCER PREVENTION
C: A
12(4)
257-63
2003
RUANO-RAVINA A, FIGUEIRAS A, LOIDI L, BARROS-DIOS JM.
GSTM1 AND GSTT1 POLYMORPHISMS, TOBACCO AND RISK OF LUNG CANCER: A CASE-CONTROL STUDY
FROM GALICIA, SPAIN.
ANTICANCER RESEARCH 23:4333-4338
C: A
23
4333-4338
2003
32
Cáncer de pulmón
RUANO-RAVINA A, FIGUEIRAS A, BARREIRO CARRACEDO MA, BARROS-DIOS JM.
OCCUPATION AND SMOKING AS RISK FACTORS FOR LUNG CANCER: A POPULATION-BASED CASECONTROL STUDY.
AMERICAN JOURNAL OF INDUSTRIAL MEDICINE
C: A
43(2)
149-155
2003
UK
RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.
LUNG CANCER AND RELATED RISK FACTORS:AN UPDATE OF THE LITERATURE
PUBLIC HEALTH
C: A
117
149-156
2003
UK
RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.
MUSICIANS PLAYING WIND INSTRUMENTS AND RISK OF LUNG CANCER: IS THERE AN ASSOCIATION?
OCCUP ENVIRON MED
C: Carta
60:
143
2003
USA
RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.
NOXIOUS EXPOSURES IN LEISURE TIME AND RISK OF LUNG CANCER: A NEGLECTED EXPOSURE?
EPIDEMIOLOGY
C: Carta
13 (2):
235-6
2002
USA
BARROS-DIOS JM, BARREIRO MA, RUANO-RAVINA A, FIGUEIRAS A
EXPOSURE TO RESIDENTIAL RADON AND LUNG CANCER IN SPAIN: A POPULATION-BASED CASECONTROL STUDY
AMERICAN JOURNAL OF EPIDEMIOLOGY
C: A
156(6)
548-555
2002
USA
PREMIO AL MEJOR ARTÍCULO DE INVESTIGACIÓN EPIDEMIOLÓGICA PUBLICADO EN 2002.
OTORGA: SOCIEDAD ESPAÑOLA DE EPIDEMIOLOGÍA
RUANO-RAVINA A, FIGUEIRAS A, DOSIL-DIAZ O, BARREIRO CARRACEDO MA, BARROS-DIOS JM.
A POPULATION-BASED CASE-CONTROL STUDY ON FRUIT AND VEGETABLE INTAKE AND LUNG CANCER:
A PARADOX EFFECT?
NUTRITION AND CANCER
C:A
43(1)
47-51
2002
USA
RUANO-RAVINA A, FIGUEIRAS A, BARROS-DIOS JM.
THE GENOMICS REVOLUTION: WILL THIS MEAN A RESURGENCE OF CUSTOMIZED PRESCRIPTIONS?
DRUG INFORMATION JOURNAL
C:Carta
36(4)
725-6
2002-11-10
USA
RUANO RAVIÑA A, FIGUEIRAS A, BARROS DIOS JM.
DIET AND LUNG CANCER: A NEW APPROACH.
EUROPEAN JOURNAL OF CANCER PREVENTION.
C: A
9(6)
395-400
Factores de susceptibilidad al cáncer de pulmón
2000
HOLANDA
33
RUANO RAVIÑA A; BARROS DIOS JM
UNA BREVE APROXIMACIÓN A LA EPIDEMIOLOGÍA DEL CÁNCER DE PULMÓN
APUNTES DE SALUD PÚBLICA
C: A
2(20)
15-17
1999
ESPAÑA
RUANO RAVIÑA A; BARROS DIOS JM
APLICACIÓN DE LOS BIOMARCADORES A LOS ESTUDIOS EPIDEMIOLÓGICOS
APUNTES DE SALUD PÚBLICA
C: A
2 (5)
5-9
1998
ESPAÑA
BARROS-DIOS JM, BARREIRO MA et al.
“CÁNCER DE PULMÓN Y RADÓN DOMÉSTICO. DESCRIPCIÓN DE UN ESTUDIO EN EL ÁREA SANITARIA
DE SANTIAGO DE COMPOSTELA:1992-1994”. En “La Sanidad Ambiental y la Salud Pública”, 1997:
117-122. ISBN-84-884 39-49-0
34
Cáncer de pulmón
Bibliografía
1.
Kawajiri K; Nakachi K; Imai K; Yoshii A; Shinoda N; Watanabe J. Identification of genetically high
risk individuals to lung cancer by DNA polymorphisms of the cytochrome P450IA1 gene. FEBS,
1990. 263 (1): 131-133.
2.
Zhong S; Wyllie AH; Barnes D; Wolf CR; Spurr NK. Relationship between the GSTM1 polymorphism
and susceptibility to bladder, breast and colon cancer. Carcinogenesis, 1993. 14 (9): 1821-1824
3.
Uematsu F; Ikewa S; Kikuchi H; Sagami I; Kanamaru R; Abe T; Satoh K Motomiya M; Watanabe M.
Restriction fragment length polymorphism of the human CYP2E1 (cytochrome P450IIE1) gene
and susceptibility to lung cancer: possible relevance to low smoking exposure. Pharmacogenetics,
1994. 4: 58-63.
4.
Alexandrie AK, Sundberg MI, Seidegard J, Tornling G, Rannung A. Genetic susceptibility to lung
cancer with special emphasis on CYP1A1 and GSTM1: a study on host factors in relation to
age at onset, gender and histological cancer type. Carcinogenesis 1994;15(9):1785-90.
5.
Wei Q, Cheng Lie, Hong WK, Spitz MR. Reduced DNA repair capacity in lung cancer patients.
Cancer Research 1996. 56: 4103-4107.
6.
García-Closas M; Kelsey KT; Wiencke JK; Xu X; Wain JC; Christiani DC. A case-control study of
cytochrome P450 1A1, glutathione S-transferase M1, cigarette smoking and lung cancer
susceptibility (Massachusetts, United States). Cancer Causes and Control, 1997. 8: 544-553.
7.
To-Figueras J; Gené M; Gómez-Catalán J; Galán MC; Fuentes M; Ramón JM; Rodamilans M; Huguet E;
Corbella J. Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) polymorphisms and lung
cancer risk among Northwestern Mediterraneans. Carcinogenesis, 1997. 18 (8): 1529-1533.
8.
Kelsey KT, Spitz MR, Zuo ZF, Wiencke JK. Polymorphisms in the glutathione S-transferase class
mu and theta genes interact and increase susceptibility to lung cancer in minority populations
(Texas, United States). Cancer, Causes and Control 1997;8:554-59.
9.
Rebbeck TR. Molecular epidemiology of the human Glutathione-S-transferase genotypes GSTM1
and GSTT1 in cancer susceptibility. Cancer Epidemiology, Biomarkers and Prevention 1997;
6: 733-743.
10.
Jourenkova-Mironova N; Wikman H; Bouchardy C; Voho A; Dayer P; Benhamou S; Hirvonen A.
Role of Glutathione S-transferase GSTM1, GSTM3, GSTP1 and GSTT1 genotypes in modulating
susceptibility to smoking-related lung cancer. Pharmacogenetics 1998. 8:495-502.
11.
Pianezza ML; Sellers EM; Tyndale RF. Nicotine metabolism defect reduces smoking. Nature, 1998.
393: 750.
12.
Oscarson M; Gullstén H; Rautio A; Bernal ML; Sinues B; Dahl ML; Stengard JH; Pelkonen O;
Raunio H; Ingelman-Sundberg M. Genotyping of human cytochrome P450 2A6 (CYP 2A6), a
nicotine C-oxidase. FEBS Letters, 1998. 438: 201-205.
13.
Butkiewicz D; Cole KJ, Phillips DH; Harris CC; Chorazy M. GSTM1, GSTP1, CYP1A1 and CYP2D6
polymorphisms in lung cancer patients from an environmentally polluted region of Poland:
correlation with lung DNA adduct levels. Eur J of Cancer Prevention 1999; 8 : 315-323.
Factores de susceptibilidad al cáncer de pulmón
35
14.
To-Figueiras J, Gené M, Gómez-Catalán J, Piqué E, Borrego N, Carrasco JL, Ramón J, Corbella J.
Genetic polymorphims of glutathione-S-transferase P1 gene and lung cancer risk. Cancer Causes
and Control 1999;10:65-70.
15.
Rojas M, Cascorbi I, Alexandrov K, Kriek E, Auburtin G, Mayer M, Kopp-Schneider A, Roots I,
Bartsch H. Modulation of benzo(a)pyrene diolepoxide-DNA adduct levels in human white blood
cells by CYP1A1, GSTM1 and GSTT1 polymorphism. Carcinogenesis 2000; 21 (1): 35-41.
16.
Stücker I, Jacquet M, de Waziers I, Cénée S, Beaune Ph. Relation between inducibility of CYP1A1,
GSTM1 and lung cancer in a French population. Pharmacogenetics 2000;10:617-27.
17.
Hou SM, Fält S, Nyberg F. Glutathione S-transferase T1-null genotype interacts synergistically with
heavy smoking on lung cancer risk. Environmental and Molecular Mutagenesis 2001;38:83-86.
18.
Bouchardy .Ch, Benhamou S, Jourenkova N, Dayer P, Hirvonen A. Metabolic genetic polymorphims
and susceptibility to lung cancer. Lung Cancer 2001; 32:109-12.
19.
To-Figueras J. Gené M, Gómez-Catalán J, Piqué E, Borrego N, Corbella J. Lung cancer susceptibility
in relation to combined polymorphims of microsomal epoxide hydrolase and glutathione Stransferase P1. Cancer Letters 2001. 173: 155-162.
20.
Zhou W, Liu G, Thurston SW, Xu LL, Miller DP, Wain JC, Lynch TJ, Su L, Christiani DC. Genetic
polymorphism in N-acetyltransferase-2 and microsomal epoxide hydrolase, cumulative cigarette
smoking, and lung cancer. Cancer Epidemiology, Biomarkers & Prevention 2002. 11: 15-21.
21.
Stücker I, Hirvonen A, de Waziers I, Cabelguenne A, Mitrunen K, Cénée S, Koum-Besson E, Hémon D,
Beaune Ph, Loriot MA. Genetic polymorphims of glutathione S-transferases as modulators of
lung cancer susceptibility. Carcinogenesis 2002;9:1475-81.
22.
Park JY, Lee SY, Jeon HS, Bae NC, Chae SC, Joo S, Kim CH, Park HO, Kam S, Kim IS, Jung TH.
Polymorphism of the DNA repair gene XRCC1 and risk of primary lung cancer. Cancer
Epidemiology, Biomarkers & Prevention 2002. 11: 23-27.
23.
Miller DP, Liu G, De Vivo I, Lynch TJ, Wain JC, Su L, Christiani DC. Combinations of the variant
genotypes of GSTP1, GSTM1, and p53 are associated with an increased lung cancer risk. Cancer
Research 2002;62:2819-23.
24.
Perera FP, Mooney LV, Stampfer M, Phillips DH, Bell DA, Rundle A, Cho S,Tsai WY, Ma J, Blackwood A,
Tang D. Associations between carcinogene-DNA damage, glutathione S-transferase genotypes,
and risk of lung cancer in the prospective Physicians´ Health Cohort Study. Carcinogenesis
2002;23:1641-46.
25.
Paz-Elizur T, Krupsky M, Blumenstein S, Elinger D, Schechtman E, Livneh Z. DNA repair activity
for oxidative damage and risk of lung cancer. J Natl Can Inst 2003. 95 (17): 1312-19.
26.
Miller DP, Neuberg D, de Vivo I, Wain JC, Lynch JC, Su L, Christian DC. Smoking and the risk of
lung cancer: susceptibility with GSTP1 polymorphims. Epidemiology 2003;14(5):545-51.
27.
Ruano-Ravina A, Figueiras A, Loidi L, Barros-Dios JM. GSTM1 and GSTT1 polymorphims, tobacco
and risk of lung cancer: a case-control study From Galicia, Spain. Anticancer Research 2003;
23:4333-38.
36
Cáncer de pulmón
28.
Alexandrie AK, Nyberg F, Warholm M, Rannug A.Influence of CYP1A1, GSTM1, GSTT1, and
NQO1 genotypes and cumulative smoking dose on lung cancer risk in a Swedish population.
Cancer Epidemiology Biomarkers & Prevention 2004. 13 (6): 908-14.
29.
Kiyohara C, Yoshimasu K, Shirakawa T, Hopkin JM. Genetic polymorphisms and environmental
risk of lung cancer: a review. Reviews on Environmental Health 2004. 19 (1): 15-38.
30.
Marin MS, López-Cima MF, García-Castro L, Pascual T, Marrón MG,Tardón A. Poly (AT) polymorphims
in intron 11 of the XPC DNA repair gene enhances the risk of lung cancer. Cancer Epidemiol,
Biomarkers & Prevention 2004;13(11):1788-93.
31.
Wenzlaff AS, Cote ML, Bock CH, Land SJ, Schwartz AG. GSTM1, GSTT1 and GSTP1 polymorphims,
environmental tobacco smoke exposure and risk of lung cancer among never smokers: a
population-based study. Carcinogenesis 2005;26(2):395-401.
32.
Perera FP; Weinstein IB. Molecular epidemiology and carcinogen-DNA adduct detection: new
approaches to studies of human cancer causation. J of Chron Dis, 1982. 35: 581-600.
33.
Taioli E, Zocchetti C, garte S. Models of interaction between metabolic genes and environmental
exposure in cancer susceptibility. Environ Health Perspect 1998; 106:67-70.
34.
Sturgis EM, Castillo EJ, Li L, Zheng R, Eicher SA, Clayman GL, Strom SS, Spitz MR, Wei Q.
Polymorphims of DNA repair gene XRCC1 in squamous cell carcinoma of the head and neck.
Carcinogenesis 1999;20:2125-29.
35.
Butkiewicz D, Rusin M, Enewold L, Shields PG, Chorazy M, Harris CC. Genetic polymorphims in
DNA genes and risk of lung cancer. Carcinogenesis 2001;22(4):593-97.
36.
Garte S et al. Metabolic Gene Polymorphims frequencies in control populations. Cancer Epidemiol,
Biomarkers & Prev 2001;10:1239-48.
37.
Garte S. Metabolic susceptibility genes as cancer risk factors: time for reassesment? Cancer
Epidemiol, Biomarkers & Prev 2001;10:1233-37. (Comentario)
38.
Ingelmana-Sundberg M, Oscarson M, Daly AK, Garte S, Nebert DW. Human cytochrome P-450
(CYP) genes: a web page for the nomenclature of alleles. Cancer Epidemiol, Biomarkers & Prev
2001;10:1307-08 (Carta)
39.
Lemon WJ, Bernert H, Sun H, Wang Y,You M. Identification of candidate lung cancer susceptibility
genes in mouse using oligonucleotide arrays. J Med Genetics 2002;39:644-55.
40.
Hou SM, Fält S, Angelini S, Yang K, Nyberg F, Lambert B, Hemminki K. The XPD variant alleles
are associated with increased aromatic DNA adduct level and lung cancer risk. Carcinogenesis
2002;23(4):599-603.
Factores de susceptibilidad al cáncer de pulmón
37
CARCINÓGENOS Y ORIGEN
DEL CÁNCER DE PULMÓN
Julián Carretero
Centro Nacional de Investigaciones Oncológicas (CNIO)
Madrid
Contenido:
Resumen de la ponencia
Bibliografía
Carcinógenos y origen del cáncer de pulmón
Julián Carretero
Grupo de cáncer de pulmón
Cantro Nacional de Investigaciones Oncológicas (CNIO) Madrid
1. Introducción
El cáncer de pulmón es el tumor más importante en cuanto a mortalidad en el mundo occidental. La
carcinogénesis pulmonar es el resultado final de la acción de múltiples factores que de forma aislada, aditiva
o sinérgica, lesionan irreversiblemente el epitelio bronquial. El cáncer es una enfermedad genética, resultado
de las alteraciones que presentan las células cancerosas en genes relacionados con el control de la
proliferación y muerte celular. Sin embargo el origen de estas alteraciones (mutaciones) es, la mayor parte
de las veces, ambiental, y en el caso del cáncer de pulmón, el principal agente ambiental implicado en la
carcinogénesis es el tabaco, responsable del 90% de los casos en varones y del 55-80% de los casos entre
las mujeres en los paises de mayor incidencia. Además, también existe una asociación segura entre exposición
ocupacional a otras sustancias (asbestos, radón, arsénico, bis-cloro-metil-éster, berilio, cromo, gas mostaza,
níquel) y aparición de cáncer de pulmón. Sin embargo, no en todos los casos de cáncer de pulmón existe
una causa concreta detectada, ni la presencia de un agente etiológico conlleva siempre la aparición de
cáncer de pulmón (p.ej. sólo el 10-15% de los fumadores desarrollará un cáncer de pulmón a lo largo
de su vida). Estos hechos hacen pensar en la existencia de efectos aditivos y sinérgicos entre las distintas
causas para determinados casos; así como en la existencia de factores de predisposición y de riesgo para
el cáncer de pulmón que quizás por sí solos no son suficientes para la carcinogénesis pero asociados a
otros factores conducen a la aparición del tumor (p.e., factores de susceptibilidad genética).
2. Tabaco y cáncer de pulmón
Los estudios epidemiológicos y experimentales señalan al tabaco como el principal factor etiológico en
el cáncer de pulmón. La consistencia de estos estudios, su especificidad, la secuencia temporal entre la
exposición y la enfermedad, y la relación dosis-respuesta avalan la evidencia de la asociación entre el
consumo de cigarrillos y el cáncer de pulmón. El tabaco induce cualquiera de los grupos histológicos
más frecuentes, existiendo una fuerte asociación con los carcinomas escamosos y los indiferenciados
de célula pequeña.
2.1. Carcinogénesis inducida por el tabaco
El humo del tabaco contiene alrededor de 4.800 compuestos diferentes, que se pueden separar en
compuestos gaseosos y partículas. Al menos 60 de estos compuestos se consideran cancerígenos por
la Agencia Internacional para la Investigación del Cáncer (IARC) en base a evidencias epidemiológicas
y experimentales. La fase gaseosa contiene moléculas potencialmente carcinogénicas como óxidos de
nitrógeno, isopreno, butadieno, benzeno, estireno, formaldehído, acetaldehído, acroleína y furano, mientras
que la fase de partículas cuenta con carcinógenos como los hidrocarburos aromáticos policíclicos (PAH),
nitrosaminas, aminas aromáticas y metales (cromo, níquel, cadmio). Si bien el efecto individual de los
carcinógenos del tabaco es dificil de estudiar a nivel molecular ya que estamos tratando un problema
de exposición crónica a una mezcla compleja de moléculas carcinógenas y/o procarcinógenas, numerosas
evidencias experimentales han demostrado la implicación del tabaco en todos los pasos de la carcinogénesis.
Carcinógenos y origen del cáncer de pulmón
41
Los compuestos carcinogénicos del tabaco se absorben y son metabolizados en los individuos fumadores,
y muchos de estos compuestos reaccionan con el DNA provocando mutaciones, hechos comprobados
experimentalmente utilizando diferentes fracciones de condensados de humo de cigarrillos aplicados
sobre animales de laboratorio, y también en experimentos de inhalación, donde se inducen alteraciones
en el DNA, así como lesiones preneoplásicas.
2.2. Principales carcinógenos del humo del tabaco
•
Hidrocarburos aromáticos policíclicos (PAH): el benzopireno es el más estudiado, y su capacidad
para inducir tumores en el pulmón tras la administración local o inhalatoria está plenamente
establecida. Además, existen otros PAH como el dibenzopireno, dibenzoantraceno y el
5-metilcriseno, cuya potencia carcinogénica es mayor pero que aparecen a menores
concentraciones en el humo del tabaco.
•
Nitrosaminas: la 4-(metilnitrosamino)-1-(3-piridil)-1-butanona (NNK) es una nitrosamina específica
del humo del tabaco y un potente carcinógeno en roedores. De hecho, es el único carcinógeno
capaz de inducir tumores en el pulmón de los tres modelos murinos de experimentación
más utilizados. Además, es el carcinógeno más abundante del humo del tabaco.
•
El 1,3-butadieno es otro de los compuestos que induce el desarrollo de tumores de pulmón
en roedores, aunque depende mucho de la capacidad detoxificadora de cada especie: en
ratones, el 1,3-butadieno es transformado en 1,2,3,4-diepoxibutano, un compuesto mucho más
reactivo y carcinogénico.
•
Radicales libres y oxidantes. En el humo del tabaco hay importantes cantidades de radicales
libres que se generan en la combustión, derivados del nitrógeno, como el óxido nítrico, o
derivados del oxígeno, como el radical superóxido o el peróxido de hidrógeno. Estas especies
altamente reactivas son capaces de oxidar, y por tanto dañar, todo tipo de macromoléculas,
entre ellas el DNA. Además, al entrar en contacto el humo del tabaco con los alveolos
pulmonares se van a activar los macrófagos alveolares, los cuales liberarán más radicales libres
que contribuyen a la inflamación. La inflamación crónica se considera hoy en dia como una
situación potencialmente carcinogénica precisamente por la genotoxicidad de las especies
oxidantes y también porque induce la activación de rutas moleculares que fomentan la
transformación tumoral.
•
Otros compuestos carcinogénicos: etilcarbamato, óxido de etileno, níquel, cromo, cadmio,
arsénico, hidrazina, formaldehído, acetaldehído.
2.3. Mecanismos de genotoxicidad inducida por el humo del tabaco
La respuesta del organismo a los carcinógenos es similar a la que ocurre durante la exposición a
cualquier xenobiótico. Muchos de estos compuestos son de naturaleza lipófila, cualidad que les permite
atravesar las membranas biológicas, y por esta misma razón son difícilmente eliminables por la principal
vía de excreción, que es la orina. Con el objeto de incrementar esta excreción el organismo somete
al xenobiótico a una serie de transformaciones que se clasifican en dos grupos:
•
42
Reacciones de Fase I: biotransformaciones que aumentan la hidrosolubilidad del compuesto
mediante la introducción de grupos o funciones de carácter polar, como hidroxilaciones, que
capacitan al compuesto para experimentar la fase siguiente. Estas reacciones son llevadas a
cabo por oxidorreductasas, entre las que se encuentran las enzimas de la familia citocromo
P450 (CYP-P450).
Cáncer de pulmón
•
Reacciones de Fase II: son reacciones de conjugación en las que los compuestos con los
grupos polares aludidos se unen a reactivos endógenos, como el glutatión, para formar derivados
más hidrosolubles, a través de la reacción catalizada por las glutatión-S-transferasas (GST).
Si bien las enzimas del sistema del citocromo P450 aumentan la polaridad de los compuestos
potencialmente tóxicos con el fin de hacerlas más fácilmente eliminables, estas mismas enzimas de
hidroxilación activan los compuestos carcinogénicos del tabaco (nitrosaminas, benzopirenos), haciéndolos
más reactivos y confiriéndoles capacidad mutagénica. Los carcinógenos activados reaccionan con el DNA
formando aductos con las bases nitrogenadas. Si estos aductos no se reparan convenientemente mediante
los mecanismos celulares pertinentes (nucleotide excision repair pathway) pueden llevar a que, durante
la replicación del DNA, se introduzcan errores en la copia, dando lugar a mutaciones. La existencia de
diferentes polimorfismos en estas enzimas detoxificadoras de xenobióticos (CYP, GST) explicarían en
parte las diferentes susceptibilidades individuales a la acción de los carcinógenos, al igual que ocurre
con las proteínas responsables de la reparación del DNA, que podríamos considerar como genes
supresores de tumores.
En el caso del benzopireno, este carcinógeno es activado por los sistemas de detoxificación para
dar benzopirenol-epóxido (BPDE), un intermediario altamente reactivo capaz de unirse covalentemente
al grupo amino exocíclico de la deoxiguanosina (dG) y formar el aducto BPDE-dG, el cual, si no es
corregido, introducirá una mutación puntual con el cambio de G por T (transversión). En el caso concreto
de la inactivación del gen supresor tumoral p53, el cual se encuentra mutado en un 40% de los casos
de cáncer de pulmón humano, se ha encontrado un patrón mutacional específico de los fumadores
relacionado con la formación de aductos BPDE-dG, en concordancia con datos experimentales obtenidos
tras tratar células del epitelio bronquial con BPDE. La selectividad de la reacción del BPDE con la
deoxiguanosina de los codones “calientes” 157, 158, 245, 248 y 273 de p53 se debería a que la formación
del aducto está facilitada cuando existe 5-metilcitosina en el dinucleótido CpG, algo que ocurre
precisamente en todas las secuencias CpG de los exones cinco al nueve de p53.
Las nitrosaminas activadas metabólicamente, el 1,3-butadieno o el cloruro de vinilo, median
reacciones de alquilación del DNA, dando lugar a sitios abásicos que al ser replicados introducirán
mutaciones, predominantemente transversiones de G a T.
3. Otros agentes cancerígenos
Como hemos explicado anteriormente, los carcinógenos del tabaco son los responsables de la mayoria
de los cánceres de pulmón, si bien existen importantes carcinógenos, especialmente relacionados con
exposiciones ocupacionales, como los asbestos o el radón. Otros factores carcinogénicos reconocidos
serían la contaminación atmosférica y la menor ingesta de vegetales y frutas frescas, alimentos ricos en
antioxidantes naturales, que hipotéticamente implicaría menor protección frente al daño oxidativo inducido
por otros carcinógenos.
3.1. Asbestos
El asbesto aumenta el riesgo de cáncer de pulmón, mesotelioma y asbestosis. Mineros, molineros,
trabajadores del textil, del cemento, frenos, máscaras y aislamientos, materiales de calefacción, constructores
de embarcaciones y similares son profesionales habitualmente expuestos al asbesto; entre ellos, el 20%
fallece de cáncer de pulmón y el 5-10% de mesotelioma. La exposición tiene un efecto dosis-respuesta
y un sinergismo con el tabaco. El riesgo relativo para el cáncer de pulmón es de 1,5 a 13,1 cuando se
Carcinógenos y origen del cáncer de pulmón
43
combinan ambos factores. Todos los tipos histológicos pueden verse aumentados, y habitualmente se
localizan en lóbulos inferiores o en localizaciones periféricas. Su acción carcinogénica se explica por la
inflamación crónica que ocasionan las fibras largas y delgadas que penetran, se retienen en los pulmones
y que los alvéolos son incapaces de expulsar. La genotoxicidad estaría mediada por la generación de
especies reactivas del oxígeno y del nitrógeno capaces de dañar al DNA. En este sentido se ha
demostrado experimentalmente que las partículas inducen por sí mismas, incubándolas en medio acuoso
junto con DNA, la generación de radicales libres como el hidroxilo, capaz de provocar oxidaciones en
las cuatro bases y roturas de la hebra de DNA. Además, cuando las partículas de asbesto son captadas
por las células fagocitarias inducen la inflamación y posterior generación de especies reactivas genotóxicas.
El producto de la oxidación del DNA más estudiado es la 8-hidroxideoxiguanosina (8-OhdG), cuya
aparición provoca transversiones de G a T y que se utiliza como marcador de daño oxidativo al DNA
al ser fácilmente detectable en muestras de tejido y orina de animales de experimentación tratados
con asbesto.
3.2. Radón
El radón es un gas inerte derivado del uranio.Tiene un débil poder radiactivo y alguno de sus subproductos
emite partículas alfa, que pueden irradiar el epitelio de las vías respiratorias; el efecto carcinogénico
vendría dado por la acción directa de la radiación, capaz de inducir roturas cromosómicas y alteraciones
en las bases nitrogenadas, y por acción indirecta al provocar la formación de radicales libres a partir
de la radiolisis o rutura homolítica del agua. Los trabajadores de las minas de uranio tienen un riesgo
mayor de muerte por cáncer de pulmón con una ratio de 12,7. El radón se ha relacionado, sobre todo,
con una mayor incidencia de carcinoma microcítico de pulmón. Aunque el radón ambiental se encuentra
en el subsuelo, en el aire, en el agua y en los materiales de construcción de los edificios, no está claro
que las observaciones de los trabajadores de las minas de uranio, con niveles de exposición más altos,
puedan extrapolarse a la población general.
Bibliografía:
1.
DeMarini DM. Genotoxicity of tobacco smoke and tobacco smoke condensate: a review. Mutat
Res. 2004 Nov;567(2-3):447-74.
2.
Donaldson MS. Nutrition and cancer: A review of the evidence for an anti-cancer diet. Nutr J.
2004 Oct 20; 3(1):19.
3.
Gazdar A, Franklin WA, Brambilla E, Hainaut P, Yakota J, Harris CC. Genetic and molecular
alterations. In: Pathology and genetics, tumours of the lung, pleura, thymus and heart, Travis WD,
Brambilla E, Müller-Hermelink K, Harris CC, eds. IARC Press, publisher. 2004.
4.
Knaapen AM, Borm PJ, Albrecht C, Schins RP. Inhaled particles and lung cancer. Part A: Mechanisms.
Int J Cancer. 2004 May 10;109(6):799-809.
5.
Pfeifer GP, Denissenko MF, Olivier M, Tretyakova N, Hecht SS, Hainaut P. Tobacco smoke
carcinogens, DNA damage and p53 mutations in smoking-associated cancers. Oncogene. 2002
Oct 21; 21(48):7435-51.
6.
IARC monograph on the evaluation of carcinogenic risk to humans: tobacco smoke and involuntary
smoking. Volume 83, IARC, Lyon, 2004.
44
Cáncer de pulmón
ALTERACIONES
GENÉTICO-MOLECULARES
EN EL CÁNCER DE PULMÓN
Montserrat Sánchez-Céspedes
Centro Nacional de Investigaciones Oncológicas (CNIO)
Madrid
Contenido:
Resumen de la ponencia
Bibliografía
Alteraciones genético-moleculares
en el cáncer de pulmón
Montserrat Sánchez-Céspedes
Grupo de cáncer de pulmón
Cantro Nacional de Investigaciones Oncológicas (CNIO) Madrid
pesar de los avances, el cáncer de pulmón es la primera causa de muerte por cáncer en nuestro
país. Evidentemente, el mayor logro conseguido hasta el momento ha sido identificar el consumo
de tabaco como el principal factor responsable de la aparición de cáncer de pulmón. A pesar de ello,
mucha gente seguirá desarrollando durante los próximos años este tipo de cáncer y, por lo tanto, es
necesario aumentar los esfuerzos para comprender los mecanismos biológicos que contribuyen a su
aparición y a su evolución.
A
El proceso de carcinogénesis se inicia y progresa debido a la acumulación de alteraciones en
genes esenciales para el crecimiento y división celular. Un objetivo básico de la investigación molecular
del cáncer es la identificación de todos aquellos genes implicados en el desarrollo tumoral y la elucidación
de sus características funcionales. Hasta la fecha se han descrito diversas alteraciones genéticas y
moleculares que caracterizan a la célula tumoral, las cuales son diversas y suelen producirse en vías
bioquímicas muy concretas. Sin embargo, no todas las proteínas implicadas en una determinada vía
bioquímica son susceptibles de alterarse genética o epigenéticamente en la célula tumoral. De hecho,
hasta la fecha tan sólo se han identificado unos pocos genes con anormalidades en la secuencia del
DNA. Las principales rutas bioquímicas que contienen genes con alteraciones genéticas o epigenéticas
y que, por lo tanto, se encuentran anormalmente reguladas en tumores incluyen: la división celular,
detección y reparación del daño al DNA, muer te celular programada (o apoptosis), factores de
transcripción, vías transductoras de señales y moléculas de adhesión celular. A continuación se describirán
las principales moléculas alteradas genéticamente en tumores pulmonares.
1. Alteraciones genéticas en componentes del ciclo celular en el cáncer de pulmón
Las alteraciones genéticas en componentes reguladores del ciclo celular son muy comunes en el cáncer.
En el caso del cáncer de pulmón los principales genes alterados son los genes supresores tumorales
retinoblastoma (Rb) y p16. Rb se altera principalmente en cáncer de pulmón de célula pequeña (CPCP)
y p16 en cáncer de pulmón de célula no pequeña (CPCNP). En ambos casos las alteraciones son
mediante mutaciones puntuales, deleciones génicas y, en el caso de p16, hipermetilación de su región
promotora. Otra alteración menos frecuente es la amplificación génica del oncogén ciclina D1. Además
de alteraciones a nivel del gen, existen alteraciones en los niveles de distintas proteínas implicadas en
el ciclo celular. Como se comentará en algunas de las sesiones del presente curso, es frecuente la
pérdida de los inhibidores del ciclo P21, P27, así como incrementos en los niveles de distintas ciclinas
(ciclina A, B, E, D) y quinasas dependientes de ciclinas (CDK1, CDK2, CDK4, CDK6) que promueven
la progresión del ciclo celular. En definitiva, todas estas anormalidades conllevan una desregularización
del ciclo celular permitiendo que se produzca una división celular constante en la célula tumoral.
Alteraciones genético-moleculares en el cáncer de pulmón
47
2. Alteraciones génicas en vías transductoras de señales bioquímicas
Las alteraciones en estas vías dan lugar a la transmisión de un estímulo constante al interior de la célula,
independientemente de los factores reguladores. El resultado suele ser un efecto mitogénico, es decir,
transmisión de señales que inducen a la célula a dividirse. De entre las mutaciones más frecuentes de
esta categoría en cáncer de pulmón están las mutaciones en Kras, en tumores de tipo histológico
adenocarcinomas. Otros genes habitualmente mutados son PTEN y LKB1, el primero en CPCP y el
segundo en adenocarcinomas. Además de alteraciones génicas existen, como en el caso anterior,
alteraciones en los niveles de ciertas proteínas implicadas en dichas vías que participan en el proceso
carcinogénico de estos tumores.
3. Alteraciones génicas en la vía de la apoptosis
La apoptosis es la muerte celular programada de una célula ante ciertos daños que son incompatibles
con su buen funcionamiento. Así, por ejemplo, cuando se produce un excesivo daño al DNA (p.e. un
exceso de radiación ionizante) se activan dentro de la célula mecanismos que promueven la reparación
de ese daño genético o, si el daño es irreparable, se promueve la apoptosis. Entre las moléculas que
regulan estos mecanismos y que se encuentran alteradas en cáncer de pulmón tenemos p53 y p14,
ambas alteradas en distintas proporciones en los distintos tipos histológicos de cáncer de pulmón.
Además de alteraciones genéticas o epigenéticas de estos componentes son comunes los cambios
en los niveles de distintas proteínas implicadas en la apoptosis como los reguladores fas, survivina,
NFKB, etc.
4. Alteraciones génicas en reguladores de la transcripción génica
En tumores pulmonares se encuentran frecuentemente amplificados los genes de la familia myc en el
CPCP. Además, se ha demostrado la presencia de mutaciones y alteraciones en los niveles de proteínas
implicadas en la regulación transcripcional a través de la remodelación de la cromatina. Así pues, son
comunes las pérdidas de BRG1/SMARCA4, el componente con actividad ATPasa del sistema regulador
de la cromatina denominado SWI/SNF.
Los genes que se han descrito alterados hasta el momento son probablemente una pequeña
parte del conjunto de genes que participan en el desarrollo del cáncer de pulmón. Estudios de alteraciones
cromosómicas globales basados en cariotipos, alelotipos, CGH (Comparative Genome Hybridization) y
otros indican que existen distintos cromosomas que presentan frecuentes ganancias o pérdidas de
material genético, lo que sugiere que debe existir oncogenes y genes supresores tumorales todavía por
identificar. De entre estas regiones cromosómicas se encuentran los cromosomas 6q, 8q, 19q y 3p.
Un aspecto muy interesante, aunque todavía poco estudiado del cáncer de pulmón, es la
identificación de genes cuyas alteraciones en línea germinal conllevan un elevado riesgo de desarrollar
cáncer de pulmón. Tal y como se expondrá en alguna de las presentes sesiones, polimorfismos en genes
que metabolizan ciertos carcinógenos parecen contribuir a un mayor riesgo de desarrollar tumores
asociados al consumo de tabaco, como cáncer de pulmón y tumores de cabeza y cuello. Además,
recientes estudios parecen demostrar que existe un gen en el cromosoma 6 responsable de la elevada
predisposición a cáncer de pulmón en individuos fumadores.
Finalmente, en la última década se están desarrollando tecnologías de análisis masivo que permiten
el estudio de la expresión global (cDNA microarrays) y de tejidos (tissue microarrays), y que impulsarán
el descubrimiento de nuevas moléculas con importancia en el desarrollo del cáncer de pulmón y permitirá
la detección de marcadores moleculares útiles en el manejo del enfermo de cáncer. En algunas de las
sesiones del presente curso se darán a conocer algunos resultados y ejemplos del uso de estas tecnologías.
48
Cáncer de pulmón
En definitiva, la descripción de las alteraciones genético-moleculares de los tumores tiene un
amplio potencial para el manejo del enfermo de cáncer ya que, en un futuro próximo, podrían ser
utilizadas a varios niveles: a) identificación de individuos con susceptibilidad a padecer cáncer; b) nuevos
marcadores para el diagnóstico precoz en individuos de alto riesgo; c) posibles marcadores con aplicación
en el pronóstico y respuesta a tratamiento del enfermo de cáncer; d) nuevas dianas para el diseño y
nuevas terapias diseñadas de forma específica a dichas alteraciones.
Bibliografía:
1.
Sánchez-Céspedes M. Dissecting the genetic alterations implicated in lung carcinogenesis. Lung
Cancer, 40(2):111-21 (2003).
2.
Osada H & Takahashi T. Genetic alterations of multiple tumor suppressors and oncogenes in the
carcinogenesis and progression of lung cancer. Oncogene, 21(48): 7421-7434 (2002).
3.
Sánchez-Céspedes M & Sidransky D. DNA-based detection of neoplastic cells for clinical cancer
management. Revista de Oncologia, .1 (6): 284-290 (2001).
4.
Sekido Y, Fong KM, Minna JD. Progress in understanding the molecular pathogenesis of human
lung cancer. Biochim Biophys Acta. 1378(1): F21-59 (1998).
Alteraciones genético-moleculares en el cáncer de pulmón
49
TELÓMEROS Y TELOMERASA
EN CÁNCER DE PULMÓN
Jean-Charles Soria
Institut Gustave Roussy
Villejuif, Francia
Contenido:
Resumen de la ponencia
Bibliografía
Ponencia en “PowerPoint”
Telomerase and telomeres in lung carcinogenesis
Jean-Charles Soria
Institut Gustave Roussy
Villejuif, France
Background
Human telomeres are simple repeated sequences of TTAGGG located at the ends of chromosomes.
Those guanine-rich structures capping the chromosome termini are essential to prevent aberrant
recombination, protect chromosomes against exonucleolytic DNA degradation and appear to be important
for the regulation of genes at distal loci (Blackburn et al, 1991; Zakian et al, 1995). Furthermore telomeres
are supposed to be involved in senescence and immortalization of normal cells. Increasing evidence
indicates that telomeric DNA shortens during the maturation of various human somatic cells (Allsopp
et al, 1995; Harley et al, 1990). Senescence of these cells may occur as a result of a checkpoint arrest
in response to shortened telomeres. The loss of telomeric repeats after each cell division may constitute
a biological clock limiting the proliferative life span of somatic cells (Allsopp et al, 1995). To compensate
for the shrinking of telomeres that results from incomplete terminal replication, germline, immortalized
and tumor cells express an RNA-dependent DNA polymerase named telomerase. The ribonucleoprotein
enzyme synthetizes the telomeric DNA repeats by using an RNA template, termed hTR, subunit of the
telomerase holoenzyme (Feng et al, 1999). The second major component, hTERT, is the catalytic subunit of the telomerase. The expression of hTERT is regulated (both positively and negatively) and tightly
correlated to the enzymatic activity (Liu et al, 1999; Oh et al, 1999). Various other proteins are also
associated with the telomerase complex (e.g. TP1, the chaperonin hsp90, and Ku, which is involved in
repair of DNA double-strand breaks), the duplex telomeric region (e.g. TRF1 and associated proteins
tankyrase and TIN2), and the single-stranded G-rich telomeric overhang (e.g. TRF2 and associated proteins
MRE11 and RAD50) (Steensel et al, 1997; Kim et al, 2000; Zhu et al, 2000; Smith et al, 2000).
Telomerase and cancer
Telomerase has been detected in the great majority of tumours investigated, establishing it as the most
widespread marker of cancer currently under study. Although, overall, telomerase activity is detectable
in around 90% of tumour samples, some specific tumour types, such as glioblastomas, astrocytomas, and
retinoblastomas, show a low proportion of telomerase positive samples (Dhaene et al, 2000). Telomerase
is preferentially expressed in tumor cells with short telomeres and is not expressed in most somatic
cells, which usually have longer telomeres. Telomerase is expressed in 80-85% of NSCLC and in almost
all SCLC (Albanell et al, 1997).
Telomerase and lung tumorigenesis
Histological changes associated with chronic smoking and cancer includes loss of cilia, cellular atypia,
reserve cell hyperplasia, squamous metaplasia and dysplasia, and carcinoma in situ. Treatment or control
of precancerous lesions may be a way to avoid the development of invasive cancers. Growing evidence
links hTERT to a multi-step model of lung cancer progression. An important question is where exactly
in cancer progression for telomerase-positive tumors is the enzyme switched on? Telomerase activity is
detected in precancerous lesions of the lung, reflecting the early involvement of the molecule in lung
tumorigenesis (Yashima et al, 1997, Soria et al, 2003). It is therefore believed that the progression from
hyperplasia to dysplasic pre-cancerous lesions is accompanied by telomerase on-switching in lung cancer.
Telómeros y telomerasa en cáncer de pulmón
53
Telomerase as a prognostic biomarker
The data supporting a role for telomerase as a prognostic indicator are compelling in several cancer
types and especially in early stage NSCLC. Telomerase activity has been correlated with cell proliferation,
higher TNM tumor stage, and node invasion (Albanell et al, 1997). The following table summarizes those
studies:
Prognostic value of hTERT in different cancer types:
Reference
Cancer
Prognostic value
Hiyama et al. 1995
Neuroblastoma
Overall survival
Hiyama et al. 1995
Gastric
Overall survival
Langford et al.1996
Meningioma
Overall survival
Clark et al. 1997
Breast
Overall survival
Tatsumoto et al. 2000
Colon
Overall survival
Marchetti et al 1999
Lung
Overall survival
Wang et al 2002
Lung
Overall survival
Telomerase and telomeres as a therapeutic targets (Hahn et al 1999, Hamilton et la, 1999, Raymond
et al, 2000; Kelland et al, 2001)
Targeting hTERT
• Reverse transcriptase inhibitors that can block telomerase because of its RNA-dependent
telomerase activity:
• AZT (IC50 mM to nM), ddG
The results are inconsistent and may be related to mitochondrial DNA replication
inhibition.
• Dominant negative hTERT approach
• Transfection of dominant-negative constructs into tumor cells
The telomerase becomes catalytically inactive but able to sequester hTR (and hTERT?)
Very promising and fits the criteria of telomerase inhibition selectivity. A problem is the
cell delivery (target cancer cells and uptake of the vector)
• Immunotherapy
hTERT is an ideal tumor antigen and hTERT can be processed by the proteosomes and
presented in an MHC context as an Ag recognized by CTLs. It has been shown that hTERTderived peptides can be recognized in this setting. Different working groups have isolated
hTERT-specific CTL able to lyse cancer cell lines and tumors in a telomerase and MHCrestricted fashion. hTERT-derived peptides can be identified for several of the prevalent
MHC haplotypes. There might be a risk of auto-immunity.
54
Cáncer de pulmón
Targeting hTR
• Ribozymes
Those are molecules that can cleave other RNAs in a sequence specific manner.
When used against hTR, there is a good telomerase inhibition and cell growth delay but
no reduction in telomere length. Use this strategy against the against hTERT messenger
RNA could be even more promising.
• Antisense oligonucleotides
Tests with standard oligodesoxynucleotides have shown disappointing results with limited
stability and bioavailability. The use of peptic nucleic acids, PNA, (analogs of DNA and RNA),
resistant to the degradation of exo and endonucleases, is more promising because PNAs
act through a specific inhibition of telomerase and fit the criteria of telomerase inhibition
selectivity. The main obstacle is still how to ensure optimal cell delivery.
Targeting the telomeres and associated proteins
The G-rich singlestrand telomere overhang can fold back on itself in vitro to form fourstrand G
quadruplex (or tetraplex) structures that then inhibit the elongation steps catalysed by telomerase.
49 Searches for compounds that bind selectively to G-quadruplexes rather than duplex DNA
resulted in the discovery of the first potent small-molecule inhibitors of telomerase. Inhibition of
telomerase by stabilization of the G-quadruplexes by porphyrin derivatives, acridine derivatives,
anthraquinones and fluorenone-based compounds are the most promising ones.
Conclusion
Telomerase has a key role in the multistep carcinogenic process of the lung, is frequently expressed in
invasive NSCLC tumors and is associated with poor outcome for some authors. The rationale for
targeting telomerase in NSCLC is robust. The first telomerase inhibitors have entered clinical trials and
may represent an exciting novel approach to cancer chemotherapy (Kelland et al, 2001). However, much
more needs to be learned rapidly, to integrate the biological properties of this enzyme to the optimum
clinical use of inhibitors. Other questions such as which tumours should be targeted, and what are
relevant pharmacodynamic markers of inhibition, must also be answered.
References
1.
Albanell J, Lonardo F, Rusch V, Engelhardt M, Langenfeld J, Han W et al. High telomerase activity
in primary lung cancers : association with increased cell proliferation rates and advanced pathologic
state. J Natl Cancer Inst 1997 ; 89 : 1609-15.
2.
Blackburn EH. Structure and function of telomeres. Nature 1991; 350: 569–72.
3.
Blackburn EH. Telomere states and cell fates. Nature 2000; 408: 53–56.
4.
Dhaene K, Marck EV, Parwaresch R.; Telomeres, telomerase and cancer: an update; Virchows
Arch. 2000; 437: 1-16.
5.
Hahn WC, Stewart SA, Brooks MW, et al. Inhibition of telomerase limits the growth of human
cancer cells. Nat Med 1999; 5:1164–70.
Telómeros y telomerasa en cáncer de pulmón
55
6.
Hiyama E, Hiyama K, Yokoyama T, et al. Correlating telomerase activity levels with human
neuroblastoma outcomes. Nat Med1995; 1: 249–55.
7.
Kelland LR. Telomerase: biology and phase I trials. Lancet Oncol 2001; 2: 95–102
8.
Kim NW, Piatyszek MA, Prowse KR, et al. Specific association of human telomerase activity with
immortal cells and cancer. Science 1994; 266: 2011–15.
9.
Marchetti A, Bertacca G, Buttitta F, et al. Telomerase activity as a prognostic indicator in stage I
non-small cell lung cancer. Clin Cancer Res 1999; 5: 2077–81.
10.
Raymond E, Soria JC, Izbicka E, Boussin F, Hurley L, Von Hoff DD. DNA G-quadruplexes,
telomere-specific proteins and telomere-associated enzymes as potential targets for new anticancer
drugs. Invest New Drugs, 2000, 18: 123-37.
11.
Soria JC, Xu X, Liu DD, Lee JJ, Kurie J, Morice RC, Khuri F, Mao L, Hong WK, Lotan R. Retinoic
Acid receptor Beta and telomerase catalytic subunit expression in bronchial epithelium of heavy
smokers. J Natl Cancer Inst 2003; 95: 165-168.
12.
Wang L, Soria JC , Kemp BL, Liu DD, Mao L, Khuri FR. hTERT Expression Is a Prognostic Factor
of Survival in Patients with Stage I Non-Small Cell Lung Cancer. Clin Cancer Res 2002; 8: 2883-2889.
13.
Yashima K, Litzky LA, Kaiser L, et al. Telomerase expression in respiratory epithelium during the
multistage pathogenesis of lung carcinomas. Cancer Res 1997; 57: 2373-7.
56
Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón
57
58
Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón
59
60
Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón
61
62
Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón
63
64
Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón
65
66
Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón
67
68
Cáncer de pulmón
Telómeros y telomerasa en cáncer de pulmón
69
LECTURA CRÍTICA
DE LOS ARTÍCULOS
SOBRE FACTORES ETIOLÓGICOS
DEL CÁNCER DE PULMÓN
Esteve Fernández
Institut Català d’Oncologia
Institut d’Investigació Biomèdica de Bellvitge (IDIBELL)
Barcelona
Contenido:
Resumen de la ponencia
Lectura crítica de los artículos sobre factores
etiológicos del cáncer de pulmón
Esteve Fernández
Servicio de Prevención y Control del Cáncer
Institut Català d’Oncologia, IDIBELL
Departamento de Salud Pública
Universitat de Barcelona
Texto preparado a partir de los materiales del curso sobre “Preparación de publicaciones biomédicas”
del Master a distancia en “Metodología de la investigación: Diseño y Estadística en Ciencias de la Salud”
de la Universitat Autònoma de Barcelona (Fernández E., García A.M. Cómo evaluar y leer artículos
científicos. Barcelona: Signo; 2005).
Agradecimientos
A Ana M. García y Josep Maria Domènech por la oportunidad de haber reflexionado y trabajado con
ellos acerca de diferentes aspectos de la publicación científica y sobre la lectura crítica de la literatura.
Se agradece la financiación de las Redes Cooperativas de Investigación en “Cáncer” (C03/010) y
“Epidemiología y Salud Pública” (C03/09) del Instituto de Salud Carlos III.
1. Introducción
La lectura crítica y sistemática de la literatura nos ayudará a conocer bien la literatura, a separar el
grano de la paja, tanto en la preparación de nuestros trabajos como en la revisión o evaluación que
podamos hacer de otros trabajos para alguna revista. En esta sesión se dan unas normas o criterios
generales para evaluar críticamente la literatura y se entra de manera individualizada en los principales
tipos de diseño y de artículos relevantes en el estudio etiológico del cáncer de pulmón.
2. Objetivos
1. Conocer los criterios generales de lectura crítica de la literatura.
2. Conocer los criterios específicos de lectura crítica de acuerdo con los principales tipos de
diseño de investigación observacional sobre el cáncer de pulmón.
3. Criterios generales para la lectura crítica de artículos
En demasiadas ocasiones se ha sacralizado “la letra impresa”: es decir, se da por válido y relevante
cualquier información que venga avalada por el peer review de una prestigiosa (o no tan prestigiosa)
revista. Es evidente que no se puede “dudar” de todo lo que cae en nuestras manos, pero sería incluso
más peligroso aceptarlo todo sin evaluación crítica. Cuando tengamos en nuestras manos un trabajo
que vayamos a incorporar a nuestro “cuerpo de conocimiento” es acertado plantearse una duda
razonable y ser sistemáticos en la lectura de ese artículo. Debemos utilizar, en la medida de lo posible,
una serie de criterios que nos ayuden a discernir acerca de si los resultados o las evidencias presentadas
son válidos, es decir, próximas a la verdad, y para decidir si los resultados son importantes.
Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón
73
Vamos a identificar cuestiones que tienen que ver con la dimensión del diseño y de los resultados
obtenidos, en términos de validez interna y externa, relevancia y utilidad práctica, que repasaremos
sistemáticamente según la presentación habitual del trabajo, es decir, según los apartados en que se
estructuran la mayoría de trabajos científicos (estructura “IMRD”). Es decir, cuando leamos críticamente
un artículo deberemos “responder” sistemáticamente a las cuestiones planteadas según la presentación
clásica del artículo para pasar a decidir sobre las cuestiones de validez, relevancia y utilidad.
Respecto a la validez interna del estudio, se tratará de evaluar si los resultados obtenidos en el
estudio se desvían o no de la realidad, es decir, si el estudio está libre de sesgos o error sistemático y
por tanto tiene una alta validez interna o no. En algunas ocasiones, grandes estudios que responden a
hipótesis y objetivos bien planteados presentan deficiencias metodológicas que hipotecan cualquier
resultado que se pueda derivar, sencillamente porque el estudio no está bien hecho. Buena parte de
los criterios sugeridos para la lectura tienen que ver con la validez interna del estudio. Si un trabajo
carece de validez interna puede ser incluso recomendable no proseguir con su lectura, puesto que
cualquier inferencia o conclusión que se pueda derivar de él carecerá realmente de valor. En muchas
ocasiones no existe una respuesta dicotómica (es válido/no es válido) a esta pregunta, y las diferentes
preguntas sobre el diseño del estudio, los pacientes incluidos y excluidos o sobre cómo se recogió la
información, ayudan a situar la respuesta en una escala entre el “absolutamente inválido” y el “absolutamente
válido”.
Algunos de los criterios que se van a presentar tienen que ver con la relevancia de los resultados,
es decir, saber qué resultados se han obtenido y con qué precisión se han estimado, para poder valorar
su importancia sanitaria, social o clínica. Por ejemplo, un estudio sobre riesgo de cáncer de pulmón y
exposición al radón puede determinar que existe un RR de 1,12 estadísticamente significativo para una
exposición al radón en el cuartil superior de su distribución (concentración 1.000 veces más elevada
que la habitual). ¿Qué importancia daremos a esa estimación?
Finalmente, la dimensión sobre utilidad de los resultados tiene que ver con su aplicabilidad en
nuestra experiencia profesional y ello tiene que ver tanto con nuestro contexto como con el contexto
en que se ha realizado la investigación cuyos resultados abordamos críticamente, es decir, con su validez
externa, entendida como generabilidad de los resultados. Por ejemplo, la efectividad de un programa
poblacional de detección precoz del cáncer de pulmón mediante PET en un estudio realizado en
Estocolmo, donde la participación es elevada (del 75%). Su aplicabilidad en nuestro ámbito (por ejemplo,
una ciudad de mediano tamaño española) puede quedar muy lejana, dado que conocemos que este
tipo de dispositivos está disponible sólo en algunos centros de alta tecnología y que la participación
en este tipo de programas no alcanzaría el 35% de nuestra población.
Debemos recordar en último lugar que la lectura crítica de artículos es una actividad (personal
o de grupo) encaminada a discernir la validez de trabajos escritos por otros colegas para nuestros
objetivos de investigación. No debemos confundir la “lectura crítica” con la lectura que haríamos para
realizar una revisión editorial por encargo como evaluadores externos (aunque los criterios propuestos
pueden servir de ayuda para ello). Por ejemplo, al valorar la “utilidad” de un artículo cuando actuamos
como evaluadores externos debemos pensar en la audiencia de la revista, mientras que en la lectura
crítica pensamos fundamentalmente en nuestra propia práctica profesional. Por ello, es conveniente
finalizar la lectura del artículo y la aplicación de los criterios respondiendo, como decíamos anteriormente,
a tres cuestiones básicas: 1) ¿el artículo es válido?, 2) ¿sus resultados son relevantes?, y 3) ¿el artículo
nos es útil?
74
Cáncer de pulmón
4. Criterios para la lectura crítica de artículos de casos y controles
Aunque en algunos textos de epidemiología los estudios de casos y controles son considerados muy
inferiores en calidad a los estudios de cohortes y mucho más susceptibles a la acción de diferentes
tipos de sesgos sistemáticos, muchos epidemiólogos consideran que un estudio de casos y controles
bien diseñado presenta muchas ventajas y muy pocos inconvenientes en comparación con los costosos
estudios de cohortes. En relación con la lectura crítica de los estudios de casos y controles se deben
considerar cuestiones comunes a la lectura de cualquier otro diseño de investigación y aspectos más
específicos de este tipo de estudios. En la Tabla 1 se resumen los criterios propios para la lectura crítica
de los estudios de casos y controles.
Un aspecto especialmente determinante de la validez en los estudios de casos y controles es la
selección de los grupos a comparar. En los estudios de casos y controles la representatividad poblacional
no es la cuestión relevante. La clave se encuentra en la medida en la que casos y controles representan
la misma población fuente o de origen. Puesto que la selección de los casos suele anteceder a la de
los controles, lo fundamental será elegir un grupo control que represente adecuadamente la población
de la que proceden los casos. Por ejemplo, si los casos se eligen a través de los servicios de un hospital,
en principio los controles más adecuados serían los que llegaran a través de la misma fuente que los
casos, es decir, la población usuaria de dicho hospital. El objetivo fundamental es que los controles
permitan estimar la distribución de la exposición o exposiciones de interés en la población base de la
que proceden los casos. Así, los controles serán los individuos que, de haber desarrollado la enfermedad,
se encontrarían en el grupo de casos incluidos en el estudio o, al menos, en el grupo de casos elegibles
para el estudio.
En un artículo que presente los resultados de un estudio de casos y controles podemos fijar
nuestro interés inicial en los casos. En primer lugar, la correcta identificación de la población origen de
los casos deberá permitirnos valorar la adecuación en el proceso de selección de los controles. En
segundo lugar, los propios criterios de selección de los casos (incidentes/prevalentes, criterios diagnósticos,
criterios de inclusión/exclusión) nos permitirán valorar la validez del estudio y las conclusiones que
podremos extraer del mismo. En principio un estudio de casos y controles basado en casos incidentes
es más sólido que si se trata de casos prevalentes. De hecho, cuando se trata de casos incidentes es
muy fácil asimilar el estudio de casos y controles al estudio de cohortes (los casos equivaldrían a los
casos que aparecerían en el estudio de cohortes y los controles serían una muestra representativa de
las cohortes de origen de los casos). Cuando se trabaja con casos prevalentes las conclusiones del
trabajo pueden ser más inciertas.
Elementos también importantes en la selección de casos y controles es la garantía de su calidad
como tales (es decir, que los casos no sean “falsos positivos” de la enfermedad, o los controles “falsos
negativos” de la misma). Los autores deberán explicar claramente los criterios diagnósticos aplicados para
la selección de los casos y los criterios utilizados para descartar la condición de interés en los controles.
Otro aspecto fundamental en ambos grupos es su representatividad respecto a los sujetos inicialmente
seleccionados (es decir, las características de la no respuesta en casos y controles). En este último sentido,
al igual que en otros tipos de diseño, es muy conveniente que los autores puedan describir las características
de participantes y no participantes en el estudio o, al menos, hagan algunas asunciones respecto al efecto
que pueda haber tenido la falta de participación de los sujetos inicialmente considerados para su inclusión
en la investigación tanto en el grupo de los casos como en el de los controles.
La medida adecuada de la exposición u otros factores de interés es igualmente importante, no
sólo en este diseño sino en cualquier otro tipo de investigación. En los estudios de casos y controles
la exposición se mide típicamente de manera retrospectiva, y por lo tanto los errores de clasificación
Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón
75
respecto a esta variable son potencialmente más probables. Tanto si la exposición se mide a través de
marcadores biológicos (que pueden utilizarse, por ejemplo, para caracterizar la exposición a sustancias
persistentes en el organismo, como es el caso de los compuestos organoclorados), como si se aborda
a través de los clásicos cuestionarios, los autores deben proporcionar toda la información relevante al
respecto para que podamos caracterizar adecuadamente la validez en la medida de la exposición y
otras variables de interés.
Por otra parte, en la presentación de los resultados, tal y como se presenta en los criterios de
la Tabla 1, deberá valorarse adecuadamente la precisión del estudio (intervalos de confianza, tamaño
muestral), así como controlar adecuadamente por las variables de confusión relevantes. Asimismo, al
tratarse de estudios fundamentalmente de naturaleza etiológica (es decir, con el objetivo de aportar
evidencias para evaluar las relaciones de causa-efecto entre la exposición o exposiciones de interés y
la enfermedad o proceso que presentan los casos) es muy importante encontrar en la discusión una
valoración adecuada de los criterios de causalidad, por ejemplo siguiendo la bien conocida propuesta
de Hill (Hill A.B. The environment and disease: association or causation? Proc R Soc Med 1965; 58: 295300): la consistencia se evaluará de acuerdo con los resultados de estudios previos sobre el mismo
tema, la secuencia temporal y el gradiente dosis-respuesta en base a la calidad y validez de la información
disponible en relación con la exposición de interés, la plausibilidad y coherencia en función del conocimiento
disponible sobre los mecanismos de acción biológica de dicha exposición y su relación con los procesos
de desarrollo de la enfermedad, etc. Por último, deberemos encontrar en el artículo una discusión
razonada y suficientemente exhaustiva de las ventajas (¿qué cualidades presenta este estudio respecto
a la investigación previa disponible en el área?) y limitaciones (¿qué problemas de precisión y validez
pueden haber afectado los resultados del estudio y de qué forma?) del estudio.
5. Criterios para la lectura crítica de artículos de cohortes
El estudio de cohortes es el diseño más lógico y directo para determinar la existencia de una asociación
entre una exposición o determinante de interés y la aparición o desarrollo de un estado de salud.
Según se defina el período de seguimiento de los participantes en un estudio de cohortes, hablamos
de cohortes prospectivas, retrospectivas o bidireccionales (prospectivas y retrospectivas). Por otra parte,
en función de los criterios de entrada y salida de los individuos de la cohorte se definen las denominadas
cohortes fijas y cohortes dinámicas. En algunos casos, en los estudios de cohortes se incluye una cohorte
única, y a continuación se clasifican los individuos en función de su estado de exposición (comparación
interna). Este es el caso del estudio de los efectos del tabaco en médicos británicos, en el cual se
clasificó a los sujetos a posteriori en función de su consumo de tabaco. En otros casos, en el estudio
se selecciona inicialmente una cohorte de individuos expuestos y se utiliza como grupo de referencia
la población general de origen de la cohorte (comparación con la población general). Por ejemplo, en
un estudio de cohortes se puede comparar la mortalidad por diferentes tipos de cáncer en trabajadores
de la industria textil con las tasas de mortalidad por esta misma enfermedad en la población general.
En ocasiones el estudio se basa en la comparación de dos cohor tes definidas y seleccionadas
deliberadamente en función de su estado de exposición al factor de interés (comparación externa).
Por ejemplo, una cohorte de personas usuarias de teléfono móvil (cohorte expuesta) con otra cohorte
de personas que no lo utilizan (cohorte no expuesta). Al igual que se comentaba en relación con los
estudios de casos y controles, en la lectura crítica de los estudios de cohortes hay aspectos más
específicos y propios de este tipo de estudios y otros comunes con cualquier diseño de investigación.
En la Tabla 2 se presentan los criterios propios a considerar en los estudios de cohortes.
Los autores deben definir claramente las características de la cohorte o cohortes en el estudio:
tipo de cohorte (fija/dinámica, retrospectiva/prospectiva, etc.), tiempos de seguimiento, criterios de
76
Cáncer de pulmón
entrada de los individuos en la cohorte, etc. En caso de una comparación con la población general se
debe presentar también la información disponible sobre la misma que pueda de alguna manera afectar
las comparaciones. Para una mínima comparabilidad entre la cohorte expuesta y la población general,
o la cohorte de comparación, habitualmente las tasas de mortalidad o la incidencia se presentarán
estandarizadas por edad. Es posible también estandarizar por otras variables que puedan relacionarse
de forma decisiva con los resultados, o bien calcular los estimadores ajustados por estas variables.
También los criterios y resultados de la medida de la exposición y la enfermedad en los estudios
de cohortes deben presentarse con toda la información necesaria para evaluar adecuadamente su
validez. La medida de la exposición puede basarse en marcadores biológicos o ambientales, cuestionarios
u otro tipo de registros o instrumentos. Aunque los estudios de cohortes tienen ventajas evidentes
para caracterizar la exposición en comparación con los estudios de casos y controles, pueden igualmente
existir problemas de validez en la aproximación utilizada para la medida de la exposición y los autores
deben proporcionar toda la información adecuada para que el lector pueda valorar críticamente este
elemento. Por otra parte, idealmente la experiencia de enfermedad se debe cuantificar de forma completa
y válida en todos los sujetos de la cohorte. La capacidad de los investigadores para conseguir este
objetivo determina de forma crucial la validez del estudio de cohortes. Asimismo, para evitar sesgos
diferenciales, es importante garantizar un nivel aceptable de equivalencia en los métodos aplicados sobre
las cohortes en comparación y sobre todos los individuos incluidos en las mismas.
La definición del período de seguimiento durante el cual se observa la experiencia de enfermedad
en los sujetos incluidos en la cohorte es clave. Este período de tiempo debe decidirse y justificarse en
función del conocimiento disponible sobre los mecanismos etiopatogénicos y el período de inducción
de la enfermedad. Por otra parte, al igual que en los estudios de casos y controles un problema
fundamental puede ser la no respuesta, en los estudios de cohortes uno de los problemas más frecuentes
serán las pérdidas de seguimiento, y los investigadores deben proporcionar la información necesaria
acerca de cómo abordaron esta cuestión y, en su caso, como minimizaron el problema. Algunos
epidemiólogos fijan el máximo admisible de pérdidas en los estudios de cohortes en el 20%, aunque
este criterio puede ser variable.
Los criterios relativos a la lectura crítica de los resultados y discusión no difieren sustancialmente
entre los estudios de casos y controles y los de cohortes. En estos últimos, los autores deberán presentar
los estimadores de frecuencia adecuados en función del tipo de diseño de cohortes (tasas de incidencia,
incidencia acumulada, tasas estandarizadas por edad, etc.) y los respectivos estimadores de asociación
(riesgos relativos, razones de incidencia, razones de mortalidad, etc.), crudos y, en su caso, estandarizados
o ajustados por las variables de confusión relevantes. Los intervalos de confianza y el tamaño muestral
nos permitirán evaluar la precisión del estudio.
Por último, en la discusión deberemos encontrar la adecuada comparación de los resultados más
relevantes con las evidencias procedentes de estudios previos. También es muy conveniente que se
incluya una reflexión respecto a los criterios habituales de causalidad, tales como la evaluación de las
relaciones dosis-respuesta o la plausibilidad y/o coherencia biológica de la asociación entre la exposición
y la enfermedad de interés. A diferencia de los estudios de casos y controles, y especialmente de los
estudios transversales, el adecuado establecimiento de la secuencia temporal es menos o nada problemática
en los estudios de cohortes, ya que precisamente en el seguimiento se obtiene información directa
sobre la relación temporal entre la exposición al factor de estudio y el desarrollo de la enfermedad.
Finalmente, la discusión debe siempre incluir la adecuada valoración crítica de los puntos fuertes y
débiles del estudio, señalando su potencial influencia sobre los resultados y las conclusiones que puedan
derivarse de los mismos.
Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón
77
Tabla 1. Criterios para una lectura crítica de los estudios de casos y controles
1. Respecto a los casos:
¿Cuál es la fuente y base del estudio de donde provienen los casos?
¿Son casos incidentes (entran en el estudio al inicio de la enfermedad) o prevalentes?
¿Se describen claramente los criterios diagnósticos de la enfermedad?
¿Se describen claramente los criterios de inclusión y, en su caso, los criterios de exclusión?
¿Se describen claramente las pérdidas en la inclusión de los casos (casos identificados vs. casos
incluidos finalmente)?
•
•
•
•
•
2. Respecto a los controles:
¿Cuál es la fuente y base del estudio de donde provienen los controles?
¿Tienen la misma probabilidad de exposición que los casos?
En caso de que enfermaran por el proceso de interés, ¿seguirían un proceso asistencial similar
al de los casos?
Si son una muestra sesgada de todos los posibles controles, ¿es este sesgo similar al que pueda
haber determinado la selección de los casos?
En el caso de existir más de un grupo control, ¿qué diferencias existen entre estos grupos y
cómo pueden afectar estas diferencias a las estimaciones de ORs? De otra forma, ¿qué sesgos
se ponen de manifiesto al utilizar los diferentes grupos de controles?
¿Se describen claramente los criterios de inclusión y, en su caso, los criterios de exclusión?
¿Se describen claramente las pérdidas en la identificación e inclusión de los controles (controles
identificados vs. controles incluidos finalmente)?
•
•
•
•
•
•
•
3. Respecto a los casos y los controles:
¿Provienen los casos y controles de la misma base del estudio?
¿Se han hecho los mismos esfuerzos para detectar/descartar la enfermedad en los casos y los
controles (es necesario asegurarse de que los controles lo son realmente)?
•
•
4. Respecto a la exposición:
¿Se ha definido y medido claramente (criterios, marcadores, duración, dosis, instrumentos y
cuestionarios validados, etc.)?
¿Se ha determinado la exposición de manera no sesgada respecto a la enfermedad estudiada
(se ha hecho el mismo esfuerzo para recoger información sobre la exposición en casos y en
controles)?
¿Se ha hecho el esfuerzo necesario para garantizar que la exposición es previa a la aparición
de la enfermedad en los casos?
•
•
•
5. Respecto a los resultados:
¿Se expresan con sus intervalos de confianza las estimaciones de las ORs?
¿Se ha tenido en cuenta tanto la significación estadística como la relevancia clínico-epidemiológica?
En el caso de resultados no significativos estadísticamente, ¿era suficiente el tamaño del estudio?
¿Se controlan los resultados por las variables de confusión relevantes?
•
•
•
•
6. Respecto a la discusión:
¿Se valoran adecuadamente los criterios de causalidad (consistencia, secuencia temporal, gradiente
dosis-respuesta, plausibilidad y coherencia, etc.)?
¿Discuten adecuadamente los autores las ventajas y limitaciones del estudio (potenciales sesgos
de selección e información y confusión y su efecto sobre los resultados)?
•
•
Adaptado a partir de:
Fletcher RH, Fletcher SW, Wagner EH. Epidemiología clínica. Barcelona: eds. Consulta; 1989.
Sackett DL, Haynes B, Guyatt GH, Tugwell P. Epidemiología Clínica. Una ciencia básica para la Medicina
Cínica. Madrid: Editorial Médica Panamericana; 1994.
78
Cáncer de pulmón
Tabla 2. Criterios para una lectura crítica de los estudios de cohortes
1. Respecto a la definición de la cohorte o cohortes:
¿Se describen suficientemente las características de la cohorte (origen, tipo de cohorte, tiempo
de seguimiento, criterios de inclusión y exclusión de los individuos en la cohorte)?
•
2. Respecto a la definición de la exposición:
¿Se ha definido y medido claramente (criterios, marcadores, duración, dosis, instrumentos y
cuestionarios validados, etc.)?
¿Se determinaron sin sesgos (se hizo el mismo esfuerzo para recoger la información en todos
los miembros de la cohorte)?
¿Se ha hecho el esfuerzo necesario para garantizar que la exposición es previa a la aparición
de la enfermedad?
•
•
•
3. Respecto a la condición de interés o enfermedad:
¿Se describen claramente los criterios diagnósticos de enfermedad?
¿Se ha realizado el mismo esfuerzo para recoger la información sobre la enfermedad en todos
los miembros de la cohorte?
•
•
4. Respecto al seguimiento:
¿Se describe adecuadamente el seguimiento para todos los miembros de la cohorte? (momento
de entrada en la cohorte, de salida o censura, y de desarrollo de la condición de estudio)
¿Se realizó el mismo esfuerzo en el seguimiento de todos los miembros de la cohorte?
¿Está definido de forma adecuada el tiempo de seguimiento (suficiente para observar el suceso
de interés)?
•
•
•
5. Respecto a los resultados:
¿Se expresan con intervalos de confianza las estimaciones de incidencia y del RR?
¿Se ha tenido en cuenta tanto la significación estadística como la relevancia clínico-epidemiológica?
En el caso de resultados no significativos estadísticamente, ¿era suficiente el tamaño del estudio?
¿Se controlan los resultados por las variables de confusión relevantes?
•
•
•
•
6. Respecto a la discusión:
¿Se valoran adecuadamente los criterios de causalidad (consistencia, secuencia temporal, gradiente
dosis-respuesta, plausibilidad y coherencia, etc.)?
¿Discuten adecuadamente los autores las ventajas y limitaciones del estudio (potenciales sesgos
de selección e información y confusión y su efecto sobre los resultados)?
•
•
Adaptado a partir de:
Fletcher RH, Fletcher SW, Wagner EH. Epidemiología clínica. Barcelona: eds. Consulta; 1989.
Sackett DL, Haynes B, Guyatt GH, Tugwell P. Epidemiología Clínica. Una ciencia básica para la Medicina
Cínica. Madrid: Editorial Médica Panamericana; 1994.
Lectura crítica de los artículos sobre factores etiológicos del cáncer de pulmón
79
Sesión II
ALTERACIONES GENÉTICO-MOLECULARES
DEL CÁNCER DE PULMÓN:
UTILIZACIÓN CLÍNICA
Moderador: Rafael Rosell
CLASIFICACIÓN HISTOLÓGICA
Y LESIONES PRENEOPLÁSICAS
EN CÁNCER DE PULMÓN
José Ramírez
Hospital Clínic
Universitat de Barcelona
Barcelona
Contenido:
Resumen de la ponencia
Bibliografía
Clasificación histológica y lesiones preneoplásicas
en cáncer de pulmón
José Ramírez
Servicio de Anatomía Patológica
Hospital Clínic. Universitat de Barcelona
1. Clasificación histológica del cáncer de pulmón
Cáncer de pulmón es un término que incluye todas aquellas neoplasias malignas que la Organización
Mundial de la Salud (OMS) define en su última clasificación de 1999(1).
El número total de variantes de cáncer pulmonar es de 46, si bien las que corresponden a más
del 95% son siempre de tipo epitelial (carcinomas), por lo que los diversos subgrupos, se reducen a
cinco tipos principales, que se indican con cursiva en la siguiente tabla:
Neoplasias malignas epiteliales de pulmón
•
•
•
•
•
•
•
•
•
Carcinoma escamoso
Carcinoma de células pequeñas
Adenocarcinoma
Carcinoma de células grandes
Carcinoma adenoescamoso
Carcinoma con elementos pleomórficos, sarcomatosos o sarcomatoides
Tumor carcinoide
Carcinoma tipo glándula salival
Carcinoma inclasificable
Tabla 1
Teniendo en cuenta que el procedimiento diagnóstico y la actitud terapéutica inicial del carcinoma
de pulmón distingue solo dos tipos, frecuentemente se habla únicamente de ellos: carcinoma de células
pequeñas (microcítico) y carcinoma de células no-pequeñas (no microcítico). Frecuentemente se confunden
los términos, de forma que no es excepcional en conferencias, e incluso en la literatura que se describa
cáncer de células pequeñas en lugar de carcinoma, que sería lo correcto.
Otra particularidad del carcinoma pulmonar es que es histopatológicamente heterogéneo. La
literatura acepta desde hace muchos años(2) éste hecho, a pesar de lo cual hasta la última clasificación
de la OMS(1) no se ha considerado abiertamente. Es en esta clasificación donde se establece que hasta
el 50% de los carcinomas tienen un segundo componente minoritario en el estudio histológico. Teniendo
en cuenta este hecho y de forma arbitraria, la OMS decide que será clasificado como carcinoma mixto
aquel que tenga al menos un 10% del componente minoritario. En el campo de la Oncología, los
carcinomas mixtos se consideran infrecuentes, por lo que siempre se indica la terapéutica de acuerdo
con el subtipo predominante.
Clasificación histológica y lesiones preneoplásicas
85
La utilización de técnicas inmunohistoquímicas para diagnóstico tumoral ha permitido conocer
con más detalle los rasgos de las células del carcinoma. Estas técnicas han permitido el estudio de
diferentes filamentos intermedios y la localización de proteínas estructurales que han dado como
resultado una diversidad de respuesta ante la aplicación de anticuerpos como citoqueratinas. La posibilidad
de realizar evaluaciones del subtipo inmunohistoquímico cruzadas con marcadores proliferativos abre
nuevas expectativas a la clasificación morfo-funcional de los carcinomas(3-4).
La generalización de técnicas de biología molecular aplicadas al conocimiento de las neoplasias
aporta por una parte la confirmación de la heterogeneidad de este grupo de neoplasias, pero por otra
parte puede conducir a la renovación completa de la clasificación. No podemos cerrar nuestra mente
a que, a medio plazo, los estudios de expresión génica permitan la clasificación de los carcinomas
pulmonares mediante subgrupos con grandes diferencias sobre los conceptos morfológicos actuales,
tanto en carcinoma de células pequeñas(5), como en otros subtipos(6).
Los criterios básicos de clasificación de éstos carcinomas se inician con la demostración de que
son tumores con rasgos de malignidad cuyas células son epiteliales y presentan o no cantidades apreciables
de citoplasma. Aquellos tumores con escaso citoplasma cuyas células se agrupan, adaptándose los núcleos
entre sí, corresponden al carcinoma de células pequeñas. Por el contrario, los tumores con células de
citoplasma amplio, que pueden diferenciarse hacia formaciones tubulares, secreción o formación de
escamas de queratina, corresponderían al grupo de los carcinomas de células no pequeñas. Estos subtipos,
si bien en el momento inicial suponen una actitud terapéutica similar, pueden recibir tratamientos
diversos, lo que hace necesaria esta amplia tipificación.
Hay dos grupos de tumores de especial interés por la dificultad diagnóstica y el confusionismo
terminológico.
En primer lugar los carcinomas neuroendocrinos. Estos tumores quedan reflejados en la Clasificación
de la OMS en varios grupos, sin homogeneizarlos, a pesar de la consideración generalmente aceptada
de que éstos tumores representan un abanico desde carcinomas poco agresivos, de bajo grado, como
el Tumor Carcinoide hasta otros de alto grado, entre los cuales se diferencia el carcinoma de células
pequeñas y el carcinoma de neuroendocrino de células grandes. El punto de confluencia de estos
tumores es la demostración de diferenciación neuroendocrina, ya sea mediante estudio inmunohistoquímico
(Sinaptofisina, Cromogranina, Enolasa Neuronal Específica o CD56) o bien mediante estudio por
microscopía electrónica.
En segundo lugar el Adenocarcinoma Bronquioloalveolar (AB), variante de adenocarcinoma que
puede presentarse con patrón puro o también con patrón mixto.
El patrón que permite el diagnóstico, siguiendo las pautas de la OMS, se corresponde con un
tumor "in situ", es decir, sin objetivarse invasión. Dentro de este concepto, hay diferente grado de
reacción estromal, siendo esto y su tamaño, criterios que algunos autores correlacionan con el pronóstico.
La generalización de la utilización de los sistemas de radiología avanzada, como el TAC helicoidal, han
permitido describir lesiones incipientes, cuya distinción entre el AB, lesiones hiperplásicas y otros tipos
de adenocarcinoma es difícil. Es aceptado que definir el componente de tipo bronquioloalveolar en
cualquier adenocarcinoma, es importante, ya que estos patrones se correlacionan con mejor pronóstico.
De esta forma, se ha demostrado que adenocarcinomas con más del 50% de patrón bronquioloalveolar
tienen mejor pronóstico a los 5 años(7).
Como comentario a esta clasificación, conviene resaltar que la caracterización definitiva de un
tumor pulmonar como carcinoma requiere el conocimiento de la clasificación de la OMS para no solo
limitarse a dividir los carcinomas en células pequeñas y no-pequeñas; sino para llegar a un diagnóstico
más exacto.
86
Cáncer de pulmón
La posibilidad de aplicar tratamientos específicos obliga a llegar al máximo en la caracterización
histológica, ya que sabemos que la diversidad celular de éstos tumores puede dificultar su tipificación.
2. Lesiones preneoplásicas bronco-pulmonares
Consideramos que las lesiones preneoplásicas son alteraciones celulares que comportan pasos intermedios
hacia el desarrollo de la neoplasia maligna. Este concepto se mezcla con el de lesiones pre-invasivas,
siendo ambos sinónimos, desde el punto de vista morfológico(1-7). Los cambios moleculares o genéticos
no se hallan bien definidos, si bien hay alteraciones morfológicas que pueden demostrarse
microscópicamente. Estos cambios morfológicos son las que a continuación se describen y se separan
en las de origen en la vía aérea, en parénquima pulmonar o en células neuroendocrinas.
Lesiones de la vía aérea. Agrupamos aquellas lesiones de la mucosa bronquial, referidas siempre
al componente epitelial y que podemos considerarlas como una progresión desde la primera, más
simple, a la más agresiva:
Hiperplasia de células basales. Consiste en el incremento del número de capas de estas células,
que representa una alteración en el equilibrio del epitelio, con predominio del componente proliferativo
sobre el maduro, ciliado, superficial.
Metaplasia escamosa. Es un proceso que habitualmente se desarrolla sobre el previo, con sustitución
del epitelio superficial, ciliado por un epitelio más resistente como es el escamoso poliestratificado. Si
bien este nuevo epitelio es anómalo, su morfología no muestra rasgos atípicos.
Displasia leve. Cuando el epitelio escamoso metaplásico comienza a sufrir alteraciones citológicas,
entramos en el concepto de displasia. En su grado inicial es una simple distorsión epitelial del área
metaplásica.
Displasia moderada. La OMS no define de forma exacta esta fase intermedia, dejando a una
evidente subjetividad su diagnóstico. En áreas de la patología diferentes del pulmón, se ha separado
únicamente la lesión displásica de alto grado de la de bajo grado, en un intento de mejorar la correlación
entre los diferentes patólogos. En el momento actual aún no ha consolidado este concepto (Kerr 2001).
Displasia severa. Esta lesión muestra ya cambios citológicos de evidente proliferación, con atipia
e imágenes de mitosis, siendo difícil de separar del carcinoma.
Carcinoma in situ. Es la lesión de máxima alteración epitelial escamosa, siempre en la superficie,
sin superar la membrana basal.
Hiperplasia adenomatosa atípica (HAA): Consiste en proliferación focal del epitelio bronquiolar
y alveolar que cubre los septos, con células cuboideas monótonas, moderadamente atípicas, con núcleo
hipercromático y citoplasma escaso, dando lugar a área sutil, de difícil visualización macroscópica, con
diámetro inferior a 5 mm. Su variable atipia y el carácter multicéntrico ocasional, le confieren una gran
dificultad diagnóstica(8). Al ser su aparición casi siempre subclínica, incidental en el estudio de una pieza
quirúrgica, su trascendencia clínica aún no se halla establecida. Su presentación puede ser como lesión
única o múltiple(1).
Proliferaciones neuroendocrinas: Son lesiones incipientes, que se han relacionado con el desarrollo
de carcinomas neuroendocrinos y cuya aparición se relaciona con simultaneidad de estos tumores.
Desde el punto de vista morfológico se encuadran como Hiperplasia Difusa Idiopática Neuroendocrina.
Únicamente se observan asociadas a otros tumores neuroendocrinos, siendo excepcional su aparición
de forma aislada.
Clasificación histológica y lesiones preneoplásicas
87
Bibliografía:
1.
Travis et al. Tumors of the lung and pleura. W.H.O. Springer, 1999.
2.
Roggli VL et al. Lung cancer heterogeneity: a blinded and randomized study of 100 consecutive
cases. Hum Pathol 1985; 16: 569-579.
3.
Bombi JA et al. Ultrastructural and molecular heterogeneity in non-small cell lung carcinomas:
Study of 110 cases and review of the literature. Ultrast Pathol 2002; 26: 211-218.
4.
Tsubokawa F et al. Heterogeneity of expresión of cytokeratin subtypes in squamous cell carcinoma
of the lung: with especial reference to CK14 overexpression in cancer of high proliferative and
lymphogenous metastatic potential. Pathol Internat 2002; 52: 286-293.
5.
Anbazhagan R et al. Classification of small cell lung cancer and pulmonary carcinoid by gene
expression profiles. Cancer Research 1999; 59: 5119-5122.
6.
Bhattacharjee A et al. Classification of lung carcinoma by mRNA expression profiling reveals distinct
adenocarcinoma subclasses. Proc Natl Acad Aci USA 2001; 98: 13790-13795.
7.
Kerr KM. Pulmonary preinvasive neoplasia. J Clin Pathol 2001; 54: 257-271.
8.
Niho S, Yokose T, Suzuki K, Kodama T, Nishiwaki Y, Mukai K. Monoclonality of atypical adenomatous
hyperplasia of the lung. Am J Pathol 1999; 154: 249-254.
88
Cáncer de pulmón
BÚSQUEDA DE MARCADORES
MOLECULARES PARA
LA DETECCIÓN PRECOZ
DEL CÁNCER DE PULMÓN
Luis M. Montuenga
Centro de Investigación Médica Aplicada (CIMA)
Universidad de Navarra
Pamplona
Contenido:
Resumen de la ponencia
Bibliografía
Búsqueda de marcadores moleculares
para la detección precoz del cáncer de pulmón
Luis M. Montuenga, María J. Pajares, María D. Lozano, Maribel Zudaire,
Jackeline Agorreta, María Collantes, Silvestre Vicent, Gorka Bastarrika,
Rubén Pío, Javier Zulueta
Área de Oncología, Centro de Investigación Médica Aplicada,
Área de Cáncer de Pulmón, Clínica Universitaria de Navarra
y Departamentos de Histología y Anatomía Patológica y Bioquímica
Universidad de Navarra
l cáncer de pulmón es la neoplasia más común y con mayor tasa de mortalidad en los países
occidentales. En España, la incidencia de cáncer de pulmón en la población masculina en los noventa
era de 78,4 casos por cada 100.000 habitantes, muy próxima a los 79,3 de la media europea. En cuanto
a la población femenina, el cáncer de pulmón ha pasado a ocupar en países como EEUU el primer
puesto en mortalidad entre los tumores malignos, incluso por delante del cáncer de mama que había
sido tradicionalmente el tipo de tumor más letal(1). Las tendencias en cuanto a incidencia y mortalidad
por cáncer de pulmón en las mujeres españolas comienzan a ser también inquietantes(2).
E
Además de ser el cáncer más frecuente, el pronóstico del carcinoma pulmonar es pobre y, lo
que es más preocupante, los innegables avances terapéuticos de los últimos 20 años han tenido escasa
repercusión en las expectativas de supervivencia de esta neoplasia. Hoy en día y de forma global, la
supervivencia a 5 años de los pacientes con carcinoma de pulmón no supera el 15%(1). Sin embargo,
el pronóstico de esta enfermedad es muy diferente según el estadio clínico-patológico en el momento
del diagnóstico. Mientras que en los estadios precoces, mediante resección quirúrgica, se consiguen
supervivencias a los cinco años próximas al 80%, en los tumores avanzados las expectativas de larga
supervivencia son menores del 10%. Desgraciadamente, tan sólo el 15% de los tumores malignos de
pulmón se encuentran en fases precoces en el momento del diagnóstico(3). La reducción de la mortalidad
por cáncer de pulmón es una prioridad en la política sanitaria. Esta reducción de la mortalidad sólo se
conseguirá en la medida en que se desarrollen estrategias eficaces en tres direcciones: disminución de
los hábitos tabáquicos, detección precoz y nuevas terapias dirigidas contra dianas moleculares.
Detección precoz mediante TAC de baja dosis
Dado que, a diferencia de otras neoplasias, no existe todavía una prueba estadísticamente validada para
la detección precoz del cáncer de pulmón, la actitud recomendada actualmente para esta neoplasia es
esperar a que aparezcan síntomas o sospechas de la enfermedad. El interés por la detección precoz
del cáncer de pulmón se ha intensificado de modo muy notable tras la publicación en 1999 en la revista
Lancet del estudio ELCAP (Early Lung Cancer Detection Program) desarrollado por Henschke y cols
en la Universidad de Cornell(4). Este estudio demostró que la utilización del TAC (Tomografía Axial
Computerizada) helicoidal con baja dosis de radiación permite detectar nódulos pulmonares malignos
de pequeño tamaño en personas de riesgo (Fig 1) y propuso esta prueba como potencial herramienta
de cribado. Asimismo se ha demostrado que el TAC helicoidal mejora notablemente la capacidad de
detección de tumores en estadios iniciales en relación a las técnicas utilizadas hasta el momento
(radiografía de tórax y citología de esputo). Entre las ventajas que se han mencionado para esta técnica
de detección precoz está la rapidez (se puede analizar el pulmón entero en menos de 10 segundos),
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
91
su sensibilidad, la baja dosis de radiación, y la posibilidad de reconstrucción tridimensional y cuantificación
automatizada. Todos estos aspectos están siendo objeto de investigación por parte de los técnicos de
desarrollo en este campo y probablemente se refinarán aún más en el futuro inmediato. Aunque hay
aspectos que deben ser estudiados a fondo antes de proponerlo formalmente a los sistemas de salud
pública, los estudios que se han publicado desde entonces siguen sugiriendo que esta técnica puede
ser una excelente herramienta para estrategias de cribado en poblaciones de alto riesgo(5-7). Es importante,
por tanto, invertir esfuerzos para validar y refinar esta tecnología de detección precoz de cáncer de
pulmón.
Figura 1: Imagen de un nódulo pulmonar detectado por TAC helicoidal de baja dosis
La experiencia en el diagnóstico precoz de otras neoplasias como mama o próstata, sugieren
que éste es el camino correcto para reducir la mortalidad por cáncer de pulmón, siempre y cuando
se cumplan una serie de requisitos técnicos y organizativos(8). A continuación (Tabla 1) traducimos la
tabla publicada por Warner y Mulshine(8) que resume los criterios que cualquier protocolo de detección
precoz debe reunir para que pueda justificarse su uso generalizado en el sistema sanitario.
TABLA 1: Criterios necesarios para poner en marcha un protocolo de cribado
en individuos de riesgo (traducido de referencia 8)
•
•
•
•
•
•
•
•
•
92
La enfermedad que se busca ha de ser un problema sanitario de importancia
La enfermedad debe tener un periodo de latencia o presintomático
La historia natural de la enfermedad, incluida el paso del estadio latente al sintomático,
debe ser adecuadamente comprendida
Debe existir una prueba adecuada con la que hacer el cribado
La prueba debería ser aceptable a la población
Debe existir un tratamiento eficaz para los pacientes con enfermedad temprana
Debe existir un consenso sobre a quiénes considerar pacientes de la enfermedad
El costo (incluido el diagnóstico y el tratamiento de los pacientes diagnosticados) debe
ser proporcional al gasto sanitario general por la enfermedad
La búsqueda de nuevos casos debe ser un proceso continuado, no algo que se lleve a
cabo una única vez
Cáncer de pulmón
No es este el momento para detenernos a comentar cada uno de estos criterios. Sin embargo,
es preciso señalar que las nuevas tecnologías de diagnóstico precoz por TAC helicoidal de baja dosis
han permitido dar pasos de gigante en relación al cumplimiento de estos criterios. Es, en efecto,
necesario seguir investigando en diversas direcciones sobre esta técnica para responder a diversos
interrogantes. Por ejemplo, conviene aclarar el efecto del uso de esta tecnología en la disminución de
la mortalidad por cáncer de pulmón en una población concreta (ensayos diagnósticos aleatorizados).
Asimismo, es preciso determinar su pertinencia desde el punto de vista del coste-beneficio. Por último,
es imprescindible aclarar muchos aspectos de la biología de las lesiones que se resecan en estos
individuos(9). No obstante, todos los datos de los estudios observacionales apuntan a que en breve
tendremos una excelente herramienta para poner en marcha estrategias de detección precoz de
cáncer pulmonar a nivel poblacional.
Biomarcadores en la detección precoz
Para que las técnicas de imagen sean realmente eficaces en programas de cribaje poblacional de detección
precoz, es necesario conseguir niveles altos de sensibilidad y especificidad. En este sentido, resulta también
especialmente interesante la posibilidad de combinar estas técnicas radiológicas con el uso de marcadores
moleculares que confirmen la presencia de células transformadas en el tracto respiratorio del paciente,
o que nos permitan conocer su perfil molecular o predecir su respuesta biológica ante tratamientos
concretos(10). En los años recientes se han identificado algunos biomarcadores que pueden ayudar a
clarificar más o menos ajustadamente la naturaleza/clasificación de una determinada neoplasia, su
pronóstico, o su capacidad de producir metástasis o responder a determinadas pautas quimioterapéuticas.
Sin embargo, la identificación de biomarcadores para la detección precoz y para lesiones premalignas
ha tenido un éxito relativamente limitado. Algunos de los trabajos se han basado en el estudio de
muestras obtenidas por métodos invasivos y caros (por ejemplo la broncoscopia) y que tienen cierto
riesgo para el paciente. Es probable que los biomarcadores que finalmente vayan a ser de utilidad
práctica para la detección precoz del cáncer de pulmón en el entorno clínico se determinen en muestras
más asequibles y menos invasivas. Un buen biomarcador que tenga posibilidades de éxito, equivalente
al PSA en próstata (aunque también tiene sus limitaciones), debería tener una serie de características,
que se resumen en la Tabla 2
TABLA 2: Características de un buen biomarcador
•
•
•
•
•
•
•
Diferente expresión en células (pre)neoplásicas respecto a células normales; o expresión
en células no neoplásicas en presencia de un cáncer
Presente y detectable en muestras mínimamente invasivas
Existe un criterio claro de validación en el tiempo, por ejemplo una situación clínicopatológica concreta y bien definida
Hay un sistema bien establecido para cuantificar sus niveles
Detectable en muestras pequeñas
Estable con el tiempo y el procesamiento de las muestras
Se puede establecer un método rutinario y automatizado de análisis
En los intentos de desarrollar nuevos biomarcadores para la detección precoz del cáncer de
pulmón, la investigación ha de recorrer necesariamente diversas fases, algunas de las cuales han sido
resumidas recientemente por Chanin y cols(11). En primer lugar hay que conocer mejor la biología de
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
93
la progresión tumoral en los diversos tipos de cáncer de pulmón. En segundo lugar, hay que delimitar
algunos candidatos entre los genes (DNA y RNA) y las proteínas alteradas, en el proceso de carcinogénesis.
Después, conviene desarrollar herramientas técnicas robustas y sencillas para analizar estas alteraciones
moleculares en muestras mínimamente invasivas. Por último, hay que validar estas tecnologías en
poblaciones de riesgo. Los protocolos de investigación organizados para validar el TAC helicoidal como
herramienta de detección precoz son el contexto idóneo para llevar adelante el análisis y la validación
de los posibles biomarcadores. De hecho, nosotros estamos recogiendo muestras de sangre y esputo
de todos los participantes en el proyecto ELCAP de la Clínica Universitaria de Navarra. A continuación
comentaremos algunos aspectos de la situación de cada una de estas fases de la investigación en relación
a los biomarcadores de detección precoz.
Genes candidatos
Para el desarrollo de tecnologías diagnósticas, basadas en marcadores moleculares, es necesario conocer
mejor las alteraciones moleculares implicadas en el desarrollo del carcinoma pulmonar, como por ejemplo
las alteraciones cromosómicas, genéticas y epigenéticas. De hecho, la urgencia por desarrollar nuevas
estrategias de detección y estrategias terapéuticas novedosas ha conducido a una búsqueda muy activa
y productiva de alteraciones cromosómicas, genéticas, epigenéticas y fenotípicas asociadas al cáncer de
pulmón. El número de genes, vías metabólicas y regiones cromosómicas relacionadas con la carcinogénesis
pulmonar es muy abundante.
La citogenética convencional y molecular ha aportado numerosos datos que demuestran abundantes
cambios cromosómicos somáticos implicados en la patogénesis del cáncer de pulmón. A pesar de la
complejidad de los cambios genómicos observados en estas neoplasias, se han detectado algunos
patrones comunes o más frecuentes. En el carcinoma escamoso, por ejemplo, son frecuentes las pérdidas
en 2q, 3p, 3q, 4q, 7p, 9q, 13q, 16q, 17p y 21q, así como las ganancias en 3q. Las ganancias en 1q23, 7p,
15q y 20q y la deleción en 6q, 13q, 18q y 19q22 se han asociado a adenocarcinomas. Sin embargo,
todavía se conoce poco de los genes localizados en esas regiones en las que probablemente puedan
hallarse oncogenes (regiones amplificadas) y genes supresores de tumores (regiones de pérdidas). Varios
grupos en todo el mundo se están especializando en el análisis de las alteraciones cromosómicas en
cáncer de pulmón, utilizando la técnica de FISH con una o múltiples sondas(12) y la técnica de hibridación
genómica comparada (CGH). Nosotros estamos desarrollando una técnica que combina el Multi-FISH
con el inmunofenotipaje, y que recibe el nombre de FICTION(13). Los estudios que han utilizado arrays
CGH como herramienta de análisis de series amplias de pacientes(14) han demostrado una alta frecuencia
de aumento selectivo de copias en varias regiones cromosómicas, así como regiones en las que el
número de copias está frecuentemente disminuido (Tabla 3).
TABLA 3: Regiones cromosómicas más frecuentemente alteradas en carcinoma
no microcítico de pulmón (NSCLC), según estudios de arrays de CGH(11)
Regiones con ganancias cromosómicas
1q31
3q25-27
5p13-14
8q23-24
Regiones con pérdidas cromosómicas
94
3p21
8p22
13q22
17p12-13
9p21-22
Cáncer de pulmón
Existen algunos rasgos moleculares específicos de la célula tumoral, resumidos magistralmente
por Hannahan y Weinberg en su revisión “The hallmarks of cancer”(15), que suelen venir determinados
por alteraciones moleculares genéticas o epigenéticas. Muchas de estas alteraciones se han asociado
específicamente a la carcinogénesis pulmonar humana.Tanto mutaciones puntuales de genes, amplificaciones
o deleciones cromosómicas, pérdidas de heterocigosidad o alteraciones de microsatélites pueden activar
oncogenes o inactivar genes supresores de tumores, perturbando por ejemplo la regulación de la
proliferación, apoptosis y angiogénesis, invasión y metástasis. La alteración epigenética mejor estudiada
es la hipermetilación del promotor de genes determinados, en especial de genes supresores de tumores.
La Tabla 4 resume los cambios moleculares más estudiados en cáncer de pulmón, que han sido revisados
recientemente por Sekido y cols(16).
TABLA 4: Principales alteraciones genéticas
y epigenéticas asociadas al cáncer de pulmón
Alteraciones génicas
SCLC
NSCLC
Mutaciones en ras
< 1%
15-20%
Amplificación de myc
15-30%
80%
Sobreexpresión de bcl-2
75-95%
10-35%
Mutación en p53
75-100%
50%
Expresión anormal de p53
40-70%
40-60%
Baja o nula expresión de Rb
> 90%
15-30%
Mutación en p16
< 1%
10-40%
Ausencia de expresión de p16
0-10%
30-70%
Hipermetilación del promotor
SCLC
NSCLC
CDH1 (E-cadherina)
60%
18-33%
CDH13 (H-cadherina)
15%
43-45%
p16
5%
25-40%
APC
15%
46-96%
RARβ
45%
40-43%
FHIT
64%
37%
RASSF1A
79-85%
30-40%
TIMP-3
/
20-26%
DAPK
/
16-44%
MGMT
16%
16-27%
En cáncer de pulmón K-ras está mutado en un 15-20% de todos los carcinomas no microcíticos
de pulmón (Non Small Cell Lung Cancer, NSCLC) y en un 20-30% de los adenocarcinomas. Las mutaciones
ocurren preferentemente en el codón 12 de K-ras, y con menor frecuencia en los codones 13 y 61.
Los genes supresores de tumores más frecuentemente alterados en el cáncer de pulmón son p53, p16
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
95
y Rb. La elevada frecuencia de deleciones en 3p21 ha generado multitud de estudios en busca de otros
posibles genes supresores localizados en esta región. Estudios mediante polimorfismos de fragmentos
de restricción (RFLPs), RT-PCR y marcadores de pérdida de heterocigosidad (LOH) han sugerido el
posible papel supresor de varios genes localizados en 3p21.3. Así, se han descrito deleciones homocigóticas
en una región de 120 kb en 3p21.3 afectando a CACNA2D2, 101F6, NPRL2, BLU, FUS1, HYAL2,
HYAL1, SEMA3B, SEMA3F y RBM5/H37, entre otros. Sin embargo, la tasa de mutación para estos genes
es muy baja (menos de 5% de los casos) en la mayoría de los estudios, sugiriendo que, en el caso de
ser supresores tumorales, la vía de inactivación no es la mutación genómica. Uno de los mecanismos
de inactivación de genes supresores frecuente en pulmón es la hipermetilación del promotor, descrita
en genes como RASSF1A (también en 3p21), RARß, TIMP-3, CDKN2A/p16, MGMT, DAPK, ECAD,
GSTP1 y también FHIT. En nuestro laboratorio estamos estudiando un potencial nuevo gen supresor
de tumores en esa región cromosómica: el gen que codifica para la proteína unidora de RNA alfaCP4(17).
También estamos investigando las alteraciones en los mecanismos de procesamiento de RNA y su
efecto en la regulación de la expresión génica en cáncer de pulmón(18).
En ciertos tumores, incluido el cáncer de pulmón, la señalización a través de factores de crecimiento
está anormalmente intensificada. La expresión de factor de crecimiento transformante beta-1 (TGF-ß1)
en cáncer de pulmón se ha asociado con angiogénesis, progresión tumoral, mal pronóstico y menor
supervivencia(19-21). El factor de crecimiento fibroblástico-2 (fibroblast growth factor-2, FGF-2) induce la
angiogénesis, proliferación y migración y algunos estudios sugieren que protege frente a la apoptosis.
FGF-2 se expresa en tumores NSCLC y esta expresión se correlaciona con mal pronóstico y menor
supervivencia(22). Asimismo, niveles elevados en suero de FGF-2 se correlacionan con un mal pronóstico
en pacientes con NSCLC y carcinoma microcítico de pulmón (Small cell lung cancer, SCLC)(22). El factor
de crecimiento epidérmico (EGF) actúa a través de su receptor (EGF receptor, EGFR/erbB1/HER1), que
tiene actividad quinasa de tirosinas y que se encuentra sobreexpresado en muchos tumores pulmonares(23).
Tras la unión al ligando, el EGFR forma homo o heterodímeros con alguno de los otros tres receptores
de su misma familia (ErbB-2, también llamado HER2/neu, ErbB-3 y ErbB-4). El EGFR se encuentra
sobreexpresado en el 40-80% de los NSCLC. HER2/neu, se encuentra sobreexpresado con frecuencia
en carcinomas pulmonares. Se ha demostrado que la sobreexpresión de HER2/neu y la sobreexpresión
simultanea de EGFR y HER2/neu, correlacionan con una peor evolución de la enfermedad en NSCLC(23).
El factor de crecimiento de hepatocitos (hepatocyte growth factor, HGF) actúa a través de un receptor
quinasa de tirosinas denominado c-met, que se encuentra sobreexpresado tanto en SCLC como en
NSCLC. Sin embargo, la sobreexpresión de HGF se ha detectado sólo en NSCLC(24). La alta expresión
de HGF en NSCLC se asocia con una menor supervivencia de los pacientes(29). En nuestro laboratorio
hemos estudiado la relevancia de un factor de crecimiento, la adrenomedulina, presente en células
normales y tumorales. También nos hemos interesado por la activación de la vía del las MAPKs en
cáncer de pulmón y su potencial utilidad diagnóstica o como diana terapéutica(25,26)
La técnica de arrays de expresión aplicada al cáncer de pulmón está proporcionando asimismo
una gran cantidad de datos y diversas listas de genes aparentemente asociados a la carcinogénesis
pulmonar. Los estudios pioneros de Garber y cols(27) analizaron la expresión génica en 67 carcinomas
pulmonares, e identificaron un patrón de expresión génica característico de cada tipo histológico. Casi
simultáneamente, Bhattacharjee y cols(28) Analizaron 186 tumores pulmonares y 17 muestras normales
y también definieron un patrón de expresión génica que diferenciaba cada tipo de carcinoma pulmonar,
distinguiendo incluso 4 subcategorías dentro de los adenocarcinomas. El estudio de Beer y cols(29) fue
diseñado específicamente para identificar patrones de expresión génica que predicen supervivencia en
cáncer de pulmón. Tras la interpretación de sus datos, seleccionaron un conjunto de 50 genes cuya
expresión podría discriminar entre grupos de pacientes de carcinoma pulmonar en estadio I con mejor
96
Cáncer de pulmón
o peor supervivencia. En su estudio sugieren que la identificación de este grupo de pacientes carcinoma
pulmonar en estadio precoz de “alto riesgo”, puede ayudar a determinar qué pacientes podrían beneficiarse
de la quimioterapia adyuvante. Estos tres estudios fueron los pioneros en la utilización de microarrays
en cáncer de pulmón. En los últimos dos años, se han seguido publicado numerosos artículos describiendo
el perfil de expresión génica del carcinoma no microcítico de pulmón en diversas series de pacientes
y utilizando diversas plataformas. Los distintos trabajos informan de perfiles de expresión génica del
cáncer de pulmón comparando situaciones variadas: mayor o menor actividad metastásica(30); grupos de
genes que distinguen el adenocarcinoma de la célula epitelial pulmonar normal(31); tumores más o menos
diferenciados(32); patrones de genes relacionados con la respuesta o la resistencia a quimioterapia(33,34,35),
etcétera.
Son ya más de 30 los artículos sobre expresión génica diferencial en cáncer de pulmón. La
combinación de arrays de CGH con arrays de expresión está generando muchos datos, que requieren
ser integrados, y abre el camino hacia una clasificación molecular de los carcinomas pulmonares. En
muchos casos las plataformas de análisis que se utilizan son diversas y los diseños experimentales y
criterios de interpretación difieren notablemente. De ahí que recientemente se estén haciendo esfuerzos
importantes en la línea de la integración, comparación y validación estadística de los datos que se
generan por las diversas tecnologías. La bioinformática tiene mucho que decir en estos momentos, para
llegar a disponer de una lista suficientemente robusta de genes que puedan ser utilizados como marcadores
diagnósticos de cáncer de pulmón(36, 37). Parmigiani y colaboradores(36) han publicado recientemente un
trabajo de comparación de los datos sobre expresión génica en cáncer de pulmón obtenidos por los
tres grupos pioneros en la utilización de los microarrays en cáncer de pulmón que ya hemos citado
anteriormente(27-29). Estos grupos utilizaron plataformas y diseños distintos. Se trata de un estudio
bioinformático complejo, con grandes dificultades metodológicas, motivadas por la gran diversidad de
los datos de partida. En su estudio concluyen que hay acuerdo, aunque incompleto, entre el patrón de
genes relacionados con la biología del cáncer de pulmón, y de hecho presentan una lista de genes que
predicen reproduciblemente el curso de la enfermedad (Tabla 5). Sin embargo, observan también niveles
importantes de variabilidad entre los estudios que puede ser el reflejo de la variabilidad biológica entre
las muestras de partida, las divergencias tecnológicas, o simplemente del azar.
Otra de las áreas de mayor interés en el campo de los biomarcadores, y en especial en la
detección precoz, es la de la proteómica. Los datos obtenidos por arrays de cDNA han proporcionado
listas amplias de genes, sin embargo la expresión de mRNA correlaciona pobremente con la de proteínas.
En la medida en que podamos analizar los patrones de expresión de proteínas de modo global y rápido
mejoraremos notablemente nuestra capacidad de comprensión de las complejidades moleculares de las
células tumorales. Los estudios iniciales de proteómica de cáncer en el contexto clínico, publicados por
el grupo de Liotta del NCI, han sugerido que el uso de los perfiles protéomicos del suero pueden
discernir entre pacientes con cáncer e individuos sanos. El estudio de Petricoin y cols(38) obtuvo el perfil
proteómico tras espectrometría de masas a partir de sueros de 50 pacientes de cáncer de ovario y
de 50 controles. Un algoritmo de análisis fue capaz de distinguir entre ambos perfiles, identificando un
patrón discriminatorio. Este patrón de picos, específico de cáncer, se utilizó para examinar otro grupo
de muestras independiente y adivinar las que eran de cáncer ovárico con un 100% de sensibilidad y
un 95% de especificidad. Más recientemente, el grupo de Carbone, ha publicado en Lancet el primer
estudio de perfiles de proteómica en cáncer de pulmón(39). En este estudio se han obtenido los perfiles
de expresión proteica de las células neoplásicas mediante la técnica de MALDI-TOF, y basados en sus
resultados han podido clasificar los tumores pulmonares en subgrupos biológicamente homogéneos,
correspondientes a las variables clinicopatológicas clásicas. Este resultado (la utilización de una tecnología
muy sofisticada para clasificar tumores ya clasificados por microscopía de luz) no tendría mayor relevancia
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
97
TABLA 5: Genes identificados como predictores significativos
de supervivencia concordantes en los tres estudios pioneros de array
de expresión en cáncer de pulmón (referencia 19)
*
Nombre
UID
Glypican 3
119651
BENE protein
185055
Iroquois homeobox protein 5
25351
Fibroblast growth factor rec. 2
278581
Folate receptor 1 (adult)
73769
Tyrosinase-related protein 1
75219
Syntaxin 1A
75671
Immunoglobulin J polypeptide
76325
MAD2 mitotic arrest def-like 1
79078
Vasc. endoth. growth factor C
79141
KIAA0101 gene product
81892
Interleukin 6 signal transducer
82065
Selectin L
82848
Rho GDP diss inhib (GDI) β
83656
* UID: unigene ID
clínica de por sí. Sin embargo, el análisis de sus datos también ha proporcionado un patrón de picos
de espectrometría de masas que clasifican a los pacientes en dos grupos de buen y mal pronóstico.
Asimismo, ha identificado dos proteínas (SUMO-2 y timosina β-4) como potenciales proteínas marcadoras
de NSCLC. Más recientemente, se han publicado otros dos estudios de proteómica en cáncer de
pulmón(40,41). El estudio de Chen y cols(40) identificó por electroforesis bidimensional una serie de puntos
aparentemente específicos de cáncer de pulmón, 33 de los cuales parecían asociados a supervivencia.
De ellos, 12 proteínas candidatas fueron confirmadas por inmunohistoquímica. En combinación con un
estudio paralelo de cDNA se identificaron 11 proteínas de la vía glicolítica como asociadas con
supervivencia baja, y en especial los niveles en suero de fosfogliceratoquinasa 1 como un ajustado
biomarcador de mal pronóstico. Ninguno de los dos estudios propone por ahora el uso de la proteómica
como biomarcador de detección precoz.
De genes específicos a biomarcadores
Hasta ahora, muchos de los esfuerzos se han dirigido a identificar los posibles genes o grupos de genes
alterados en el proceso de carcinogénesis pulmonar. Se han buscado básicamente herramientas para
una clasificación molecular del cáncer de pulmón, y para entender mejor el proceso de carcinogénesis.
Recientemente Meyerson y cols(42) han resumido los datos disponibles hasta la actualidad en esta fase
del descubrimiento de biomarcadores. Chanin y cols(11) han realizado el esfuerzo de compilar una lista
de biomarcadores prometedores para la detección precoz, aunque el grado de desarrollo de cada uno
98
Cáncer de pulmón
es muy variable, y ninguno está validado. En el supuesto de que lleguemos pronto a consensuar una
lista de estas alteraciones, habremos llegado sólo a cubrir un primer paso de nuestro trayecto, que
terminará con la utilización rutinaria de marcadores moleculares para el diagnóstico precoz. El siguiente
paso es desarrollar técnicas para detectar estas alteraciones, no sólo en los tejidos tumorales sino en
otras muestras biológicas que puedan obtenerse en la rutina clínica y de modo mínimamente invasivo.
Al proceso de descubrimiento de marcadores candidatos, le sigue la puesta a punto de técnicas para
demostrarlo en las muestras clínicas. ¿Qué muestras clínicas pueden ser informativas de la presencia de
un tumor pulmonar en estadios precoces? A continuación, mencionaremos el tipo de muestras biológicas
de las que se puede obtener información desde el punto de vista de los biomarcadores (Fig 2). Nos
referiremos, en concreto, sangre, a biopsias del tumor, cepillado bronquial, lavado bronquioalveolar,
punción aspirativa con aguja fina (FNA), esputo inducido, y exhalado respiratorio, poniendo algunos
ejemplos en relación a la posible utilidad de estas muestras y señalando ventajas e inconvenientes.
Figura 2: Posibles fuentes de biomarcadores: A: sangre; B: lavado bronquioalveolar y esputo; C: exhalado
respiratorio
Biomarcadores en sangre
La gran ventaja del análisis de biomarcadores en sangre, sea suero o plasma, es la facilidad de obtener
y procesar las muestras, la mínima invasividad y el hecho de que se han desarrollado ya numerosas
tecnologías para el análisis masivo y rápido de numerosos casos. De hecho, la búsqueda de biomarcadores
de cáncer de pulmón en sangre es la que comenzó más tempranamente. El gran inconveniente de este
tipo de muestra es que los cambios en el medio interno pueden provenir de cualquier localización del
organismo y no tienen por qué reflejar únicamente las alteraciones que ocurren en el pulmón. La
presencia de células tumorales de cáncer de pulmón circulantes es conocida desde hace tiempo(43), pero
probablemente sea menos relevante en los tumores de estadio precoz muy localizados. En todo caso,
el biomarcador en sangre, paralelo por ejemplo a lo que ocurre con el PSA, sería sin duda un biomarcador
ideal. En este sentido, los trabajos sobre detección en suero o plasma de mutaciones de k-ras(44,45)
o p53(46), alteraciones de microsatélites(46,47), DNA circulante(48), LOH para varias regiones(49), y metilación
aberrante de diversos promotores(50,51,52) son buenas bases para el desarrollo de los biomarcadores de
detección precoz basados en en análisis de sangre. Es muy probable que la estrategia de desarrollo de
biomarcadores se concrete más adelante en forma de un análisis simultáneo de una batería más o
menos amplia de alteraciones. El trabajo publicado recientemente por el grupo de Pastorino y Sozzi,
es un ejemplo en esta línea. Su estudio(46) presenta un análisis simultáneo de mutaciones de p53, y
alteraciones de microsatélite para el lugar de FHIT y otras regiones de 3p en pacientes de carcinoma
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
99
pulmonar. Existen también propuestas para el análisis de niveles de algunos factores de crecimiento en
suero, como VEGF, que parecen tener valor pronóstico(53). Además, la concentración en suero de
VEGF-C parece que puede tener utilidad diagnóstica en combinación con TAC helicoidal(54). Sin embargo,
una revisón reciente comparando los resultados de diversas publicaciones arroja cierta duda sobre la
utilidad de la medida de factores de crecimiento como marcadores tumorales en cáncer de pulmón(55).
Según ese mismo estudio los datos más convincentes son los que se refieren a la medida en suero del
marcador Cyfra 21-1 (fragmentos de citoqueratina 19), para el que la mayoría de los trabajos publicados
han presentado resultados positivos como marcador de NSCLC. Los niveles de Cyfra 21-1 han sido
analizados en poblaciones amplias de pacientes con resultados significativos en cuanto a su valor
pronóstico(56).
Como se puede deducir por lo expuesto hasta ahora, ninguna de las publicaciones mencionadas
plantea por el momento el análisis prospectivo de individuos de alto riesgo con intenciones de detección
precoz. Como hemos dicho más arriba, estamos todavía en los primeros pasos de la investigación
dirigida a encontrar el biomarcador más adecuado para la detección precoz.
Análisis de biomarcadores en otras muestras biológicas
Como hemos dicho anteriormente, la desventaja del análisis de biomarcadores en suero o plasma es
que la presencia de un biomarcador en sangre no es informativa en relación al origen local de ese
biomarcador. Otras muestras biológicas como el lavado bronquioalveolar, el esputo o las biopsias
(obtenidas por broncoscopia o punción por aguja fina) nos proporcionan datos que proceden de la
composición molecular de fluidos procedentes de las vías áreas, es decir, “geográficamente” mucho más
cercanos a las posibles células neoplásicas o preneoplásicas del pulmón. Las muestras citadas se pueden
comparar al parte meteorológico emitido por la estación local, que es siempre mucho más exacto y
ajustado, en comparación a la información que proporciona sobre esa misma localidad el servicio
meteorológico nacional, basado en la información general de todo el planeta obtenida por el satélite.
El análisis de las biopsias que proporciona el broncoscopista, las células de un aspirado de aguja fina
de un nódulo periférico, del material exfoliativo del cepillado bronquial, del lavado bronquioalveolar, del
esputo inducido o del exhalado respiratorio nos informan única y exclusivamente de los cambios
celulares o moleculares que ocurren en el epitelio del pulmón o las vías aéreas. De ahí su ventaja
teórica de partida.
Desde el punto de vista del conocimiento de la historia natural y la carcinogénesis de los nódulos
detectados por TAC helicoidal, el material biológico más preciado son las células enteras y los restos
celulares obtenidos en la punción de aguja fina de estos nódulos. Son todavía pocos los grupos
multidisciplinares que tienen incorporada la FNA de los nódulos detectados por TAC helicoidal, en
especial en el caso de los nódulos de tamaño más reducido. Aunque hay algunas publicaciones referidas
al análisis citológico de estas células, utilizando técnicas de tinción convencional(57), no existen estudios
moleculares con este material realizados en relación a la detección precoz mediante TAC helicoidal.
Fuera de este contexto, el análisis morfológico de muestras citológicas obtenidas por punción de aguja
fina o broncoscopia es un método importante en el diagnóstico del carcinoma broncogénico. Sin
embargo, la sensibilidad de este método no es completa (entre el 60 y el 80%). Warner y cols(58) han
utilizado RT-PCR semicuantitativa para evaluar la expresión relativa de c-myc, E2F1 y p21 como
metodología complementaria al análisis morfológico, aumentando notablemente la sensibilidad diagnóstica.
El análisis molecular de las biopsias obtenidas por broncoscopia es equivalente al que se puede
hacer en cualquier muestra de resección. Se han llevado a cabo numerosos estudios en relación a este
material, cuyo resumen está fuera del objetivo de este trabajo. El material de broncoscopia es muy útil
100
Cáncer de pulmón
para el diagnóstico de lesiones preneoplásicas y neoplásicas en las vías aéreas más centrales y es un
material muy valioso para estudiar los cambios moleculares sucesivos en el proceso de carcinogénesis
pulmonar, en especial del carcinoma escamoso(59, 60). Sin embargo, se obtiene por medios relativamente
invasivos y caros, y difícilmente se impondrá como estrategia de rutina para la detección precoz. McWilliams
y cols.(61) han proporcionado algunos datos que sugieren que el cribado de individuos de alto riesgo
mediante una combinación de tres técnicas, TAC helicoidal y broncoscopia de fluorescencia, tras análisis
previo de la citología del esputo, podría constituir un nuevo paradigma para organizar la detección precoz
a nivel poblacional. La complejidad de esta propuesta desde el punto de vista logístico, y su dudosa
eficiencia desde el punto de vista del coste-beneficio han sido subrayadas recientemente(62).
Desde el punto de vista del análisis rutinario de biomarcadores, probablemente el lavado
bronquioalveolar (BAL), pueda llegar a ser más informativo y práctico que la biopsia,. De hecho, son
numerosos los trabajos recientes que informan de la detección de potenciales biomarcadores de cáncer
de pulmón (DNA, RNA o proteínas) en lavado bronquioalveolar. Por ahora, la mayor parte de los
estudios son ensayos de desarrollo tecnológico (proof of concept) en un número limitado de muestras.
Con técnicas suficientemente sensibles, se pueden detectar en el BAL alteraciones de microsatélites
propias del cáncer de pulmón(63). Carstensen y cols(64) pudieron encontrar, tanto en sobrenadante como
en la fracción celular del BAL, DNA amplificable y de calidad. Casi el 50% de los pacientes de cáncer
de pulmón fueron positivos para alteraciones de microsatélites en el BAL. Existen también varios trabajos
recientes en la literatura que demuestran que en el BAL se puede analizar la metilación aberrante del
promotor de diversos genes, y sugieren que esta técnica podría ser eficaz en la detección precoz del
cáncer de pulmón(65,66,67)
Desde el punto de vista de la detección precoz, hay muchas esperanzas puestas en el uso del
esputo como fuente de detección de biomarcadores de cáncer de pulmón. El esputo es una muestra
no invasiva y fácil de obtener, aunque normalmente requiere un protocolo de inducción que garantice
la calidad de la muestra, de modo que sea informativa no sólo de las vías altas, sino también del pulmón
periférico. Recientemente, Thunnissen(68) ha revisado los datos disponibles en la literatura sobre el análisis
de esputo y su papel en la detección del cáncer de pulmón. La citología convencional de esputo,
buscando células epiteliales anormales, es una técnica de rutina. El estudio citopatológico rutinario ha
demostrado poca eficacia relativa en los protocolos de cribado de individuos de alto riesgo para la
detección precoz de cáncer de pulmón que se llevaron a cabo a finales de los años 70(69). Sin embargo,
algunos estudios recientes subrayan la utilidad del análisis de anormalidades del esputo como marcadores
del desarrollo de cáncer de pulmón en una población de alto riesgo(70,71). El desarrollo de las técnicas
de biología molecular y de análisis de imagen han abierto nuevas perspectivas muy prometedoras para
el uso del esputo como fuente de información sobre la presencia o el perfil biológico de un carcinoma
pulmonar. La citometría semiautomatizada del esputo se ha propuesto como una herramienta
potencialmente útil para protocolos de cribado y detección precoz(72). El análisis inmunocitoquímico del
esputo con anticuerpos contra proteínas propias de las células neoplásicas es otro campo de interés.
De hecho, el análisis del esputo con anticuerpos contra hnRNP A2/B1 se propuso hace unos años
como una herramienta potencialmente útil(73), sin embargo la afinidad y especificidad de los anticuerpos
monoclonales utilizados no los hace óptimos como herramienta de cribado. Posteriormente se propuso
utilizar otros anticuerpos contra hnRNP B1(74), pero esta técnica también requiere refinamiento y validación.
En todo caso, la aproximación inmunohistoquímica es sin duda una manera de aumentar la sensibilidad
de la técnica citológica. Nuestro grupo está desarrollando en este momento una tecnología teóricamente
mucho más informativa que combina el inmunofenotipaje de las células con el análisis de alteraciones
genéticas mediante la técnica de multi-FISH(13).
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
101
El objetivo de la detección precoz con muestras de esputo son las células neoplásicas o
preneoplásicas presentes en la muestra, que normalmente suponen una fracción muy pequeña de todas
las células (frecuentemente menos de un 1%). Además de las células, es posible que haya restos celulares
disueltos en el fluido, que también puedan ser informativos, por ejemplo por su contenido en DNA
desnudo de las células tumorales. La baja cantidad relativa de DNA tumoral (menos de un 1%) respecto
al resto supone que las técnicas de análisis que se utilicen para estudiarlo han de ser especialmente
sensibles. En su revisión, Thunnissen(68) describe con detalle las diversas tecnologías que se han propuesto
para el estudio de alteraciones en el DNA. Utilizando tecnología especialmente sensible, se detectan
ya en muestras de esputo mutaciones de k-ras(75,76,77). En los últimos años se han publicado artículos
sobre detección de alteraciones de microsatélite y metilación aberrante de promotores(78,79). En el trabajo
de Palmisano y cols(79) se demuestra que la alteración molecular es detectable en el esputo inducido
hasta 3 años antes del diagnóstico clínico. El reto de la utilización del esputo como fuente de información
sobre el epitelio respiratorio y, en especial, sobre la presencia de marcadores (pre)neoplásicos es un
reto puramente técnico. Por ejemplo, en relación a lo comentado hasta ahora, es imprescindible asegurar
unos niveles muy altos de robustez, control de calidad y reproducibilidad, de modo que se puedan
confirmar estos hallazgos iniciales esperanzadores en poblaciones de alto riesgo más numerosas. En el
caso de la metilación es de especial importancia la homogeneización de protocolos y la protección
frente a falsos positivos o negativos. También es un reto técnico poner a punto técnicas para valorar
los perfiles de expresión y la presencia de determinados mRNA y proteínas utilizando como muestra
de partida el esputo, que es un fluido cargado de proteasas y RNasas. De ahí que el avance de la
tecnología microarray y de la proteómica sea todavía muy lento en cuanto se pretende estudiar el
esputo inducido.
Estrategias de futuro
Después de referirnos a muestras en las que se está estudiando activamente, terminaremos con algunos
datos sobre una nueva estrategia de detección de biomarcadores para cáncer de pulmón, que se han
propuesto recientemente. Nos referimos en concreto al análisis de biomarcadores en el exhalado
respiratorio. Dentro de las cavidades respiratorias (alvéolos y sacos alveolares) se da un activo intercambio
gaseoso, y también una salida de algunos fluidos al medio extracelular. Algunos de esos fluidos y gases
pueden contener información valiosa, que en teoría, con técnicas suficientemente sensibles podría ser
detectable. El análisis del exhalado respiratorio está en su infancia más absoluta, pero sin duda es una
idea prometedora, que podría ayudar en los protocolos de detección precoz por imagen, quizás
informando de la presencia de un núcleo de células tumorales oculto al radiólogo. El concepto teórico
que subyace a estos análisis es el de que hay numerosos compuestos orgánicos volátiles en la sangre
y en el aire exhalado de cualquier individuo, y que la concentración o composición relativa de estos
compuestos son diferentes en el aíre exhalado por un paciente con cáncer y un paciente normal(80).
Un reciente estudio va más allá al demostrar la posibilidad de detectar DNA secuenciable, y en concreto
mutaciones de p53, en el condensado del aire exhalado. El condensado se obtiene haciendo respirar
al paciente durante 10-20 minutos a través de un dispositivo de recogida que condensa la humedad
del aire respirado enfriándolo rápidamente(81). Todavía no hay datos comparativos con casos pareados
entre estas tecnologías que analizan el aire exhalado y otras tecnologías propuestas para la búsqueda
de biomarcadores.
Antes de que se pueda poner marcha un protocolo eficaz de cribado para la detección precoz
del cáncer de pulmón se requiere una serie de condiciones, que por ahora ningún biomarcador para
esta neoplasia reúne. Uno de los beneficios de tener un reto tan exigente es que el desarrollo tecnológico
mantiene un ritmo muy fuerte y poco conformista. Se trata de aumentar la sensibilidad y especificidad
102
Cáncer de pulmón
de las tecnologías, incidiendo no sólo en aspectos clave como el procesamiento y conservación de las
muestras, sino también desarrollando nuevas tecnologías más eficaces. Algunos ejemplos de reciente
desarrollo tecnológico, publicados en la literatura de la detección precoz de cáncer de pulmón son: la
mejora de las técnicas de hibridación cromosómica (FISH) para células exfoliativas(82,83), y el intento de
poner a punto protocolos de proteómica sobre muestras obtenidas de microdisección (aunque para
este trabajo requirieron 15.000 golpes de láser por muestra…)(84) Brambilla y cols(85) subrayan como
conclusión de un reciente artículo de revisión sobre biomarcadores en cáncer de pulmón que los
biomarcadores entrarán en el contexto clínico en la medida en que se llegue a la automatización y
miniaturización perfecta de estas técnicas, lo que también permitirá que sean aplicadas de modo extenso
una vez validadas clínicamente. Recientemente, por ejemplo, se ha presentado una tecnología que analiza
de modo automatizado las mutaciones del codón 12 de k-ras en muestras de cáncer de pulmón(86).
Como acabamos de ver, en los últimos tres o cuatro años se han llevado a cabo numerosos
estudios basados en diversas tecnologías, incluidas las tecnologías microarray y proteómica, para definir
el perfil propio de expresión de génica del cáncer de pulmón. Aunque la interpretación de estos estudios
en su conjunto no es fácil, se trabaja con una lista de genes que podrían ser buenos candidatos como
biomarcadores. Probablemente, el análisis de biomarcadores para detección precoz no se llevará a cabo
en el futuro sobre un único gen, sino en baterías de varios genes estudiados con diversas tecnologías.
También hemos mencionado que existen una serie de genes clave, que están alterados en un porcentaje
alto de tumores pulmonares y que en la actualidad están siendo analizados en series más amplias de
pacientes. Por último, hemos comentado las diversas muestras sobre las que se puede diseñar el análisis
con las variadas herramientas tecnológicas disponibles.
Imaginemos que ya hemos conseguido el análisis más sencillo del biomarcador más prometedor
en la muestra más asequible. ¿Hemos terminado el trabajo? Por supuesto que no. Falta la validación de
los resultados en poblaciones amplias de individuos, para demostrar que en efecto ese biomarcador es
útil en el contexto clínico. Henscke insiste en un reciente editorial(62) que los investigadores implicados
en el desarrollo de biomarcadores deben reconocer que ningún biomarcador será aceptado a menos
que se demuestre que es efectivo en un estudio clínico cuidadosamente diseñado. Nuestro grupo trabaja
activamente en un proyecto de validación de biomarcadores para la detección precoz del cáncer de
pulmón que se está llevando a cabo en el Grupo Europeo de Detección Precoz de Cáncer de Pulmón
(EU-ELCDG)(87). En estudiamos una batería de marcadores bien conocidos desde diversos puntos de
vista: optimización y estandaríación, validación y análisis de numerosas muestras. En febrero de 2005
habremos reclutado 1200 pacientes de estadios iniciales de cáncer de pulmón y 2500 controles y
habremos procesado las muestras biológicas (sangre, biopsia de resección tumoral y normal, sangre,
lavado bronquioalveolar) de estos pacientes. De ellos un porcentaje relativamente bajo se presentarán
más adelante con un segundo primario. Nuestro estudio persigue identificar una lista de biomarcadores
que sea capaz de predecir la aparición de un segundo primario de pulmón.
En una revisión muy reciente, Petty y colaboradores(88) se preguntan cómo llevar los impresionantes
hallazgos de la Biología Molecular del cáncer de pulmón de la mera Biología a la aplicación clínica real.
Hay muchas preguntas concretas que se pueden hacer también en relación a la aplicación clínica de
los biomarcadores en la detección precoz del cáncer de pulmón. Estas preguntas hay que ir resolviéndolas
en los próximos años. Mientras tanto, nuestro papel es seguir construyendo con esfuerzo y entusiasmo
el edificio de la detección precoz, apoyándolo sobre los sólidos cimientos que se han construido en
los últimos años.
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
103
Bibliografía:
1.
Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, and Thun MJ. Cancer statistics, 2003; CA Cancer
J Clin. 53: 5-26, 2003.
2.
Franco J, Perez-Hoyos S, and Plaza P. Changes in lung-cancer mortality trends in Spain; Int J Cancer.
97: 102-105, 2002.
3.
Merrill RM, Henson DE, and Barnes M. Conditional survival among patients with carcinoma of
the lung; Chest. 116: 697-703, 1999.
4.
Henshke CI, McCauley DI, Yankelevitz DF, Naidich DP, McGuinness G, Miettinen OS, Libby DM,
Pasmantier MW, Koizumi J, Altorki NK, and Smith JP. Early Lung Cancer Action Project: overall
design and findings from baseline screening; Lancet. 354: 99-105, 1999.
5.
Henschke CI, Naidich DP,Yankelevitz DF, McGuinness G, McCauley DI, Smith JP, Libby D, Pasmantier
M, Vázquez M, Koizumi J, Flieder D, Altorki N, and Miettinen OS. Early lung cancer action project:
initial findings on repeat screenings; Cancer. 92: 153-9, 2001.
6.
Mulshine JL and Henschke CI. Prospects for lung-cancer screening; Lancet. 355: 592-593, 2000.
7.
Pastorino U, Bellomi M, Landoni C, De Fiori E, Arnaldi P, Picchio M, Pelosi G, Boyle P, and Fazio
F. Early lung-cancer detection with spiral CT and positron emission tomography in heavy smokers:
2-year results; Lancet. 362: 593-597, 2003.
8.
Warner EE and Mulshine JL. Lung Cancer Screening with spiral CT: toward a working strategy;
Oncology. 18: 564-587, 2004.
9.
Bach PB, Kelley MJ, Tate RC and McCrory DC. Screening for lung cancer. A review of the current
literature; Chest. 123: 72S-82S, 2003.
10.
Montuenga LM and Mulshine JL. New molecular strategies for early lung cancer detection; Cancer
Invest. 18: 555-63, 2000.
11.
Chanin TD, Merrick DT, Franklin WA and Hirsh FR. Recent developments in biomarkers for the
early detection of lung cancer: perspectives based on publications 2003 to present; Curr Opin
Pulmonol. 10: 242-247, 2004.
12.
Berrieman HK, Ashman JN, Cowen ME, Greenman J, Lind MJ and Cawkwell L. Chromosomal
analysis of non-small-cell lung cancer by multicolour fluorescent in situ hybridization; Br J Cancer.
90: 900-905, 2004.
13.
Zudaire I, Pío R, Martín-Subero I, Lozano MD, Blanco D, García López JJ, Odero de Dios MD,
Rey N, Zulueta J, Siebert R, Calazanz MJ and Montuenga LM. FICTION as a new tool to early
lung cancer diagnosis; An Sist Sanit Navar. 25: 305-315, 2002.
14.
Balsara BR and Testa JR. Chromosomal imbalances in human lung cancer; Oncogene. 21: 68776883, 2002.
15.
Hanahan D and Weinberg RA. The hallmarks of Cancer; Cell. 100: 57-70, 2000.
16.
Sekido Y, Fong KM and Minna JD. Molecular genetics of cancer; Annu Rev Med. 54: 73-87, 2003.
17.
Pío R, Zudaire I, Pino I, Castaño Z, Zabalegui N, Vicent S, García-Amigot F, Odero MD, Lozano
MD, García-Foncillas J, Calasanz MJ and Montuenga LM. AlphaCP-4, a putative tumor suppressor
gene at 3p21, but not its alternative splice variant alphaCP-4, is underexpressed in lung cancer;
Cancer Res. 64: 4171-4179, 2004.
104
Cáncer de pulmón
18.
Pino I, Pío R, Toledo G, Zabalegui N, Vicent S, Rey N, Lozano MD, Torre W, García-Foncillas J and
Montuenga LM. Altered patterns of expression of members of the heterogeneous nuclear
ribonucleoprotein (hnRNP) family in lung cancer; Lung Cancer. 41: 131-143, 2003.
19.
Barthelemy-Brichant N, David JL, Bosquee L, Bury T, Seidel L, Albert A, Bartsch P, Baugnet-Mahieu
L and Deneufbourg JM. Increased TGFbeta1 plasma level in patients with lung cancer: potential
mechanisms; Eur J Clin Invest. 32: 193-198, 2002.
20.
Hasegawa Y, Takanashi S, Kanehira Y, Tsushima T, Imai T and Okumura K. Transforming growth factorbeta1 level correlates with angiogenesis, tumor progression, and prognosis in patients with nonsmall
cell lung carcinoma; Cancer. 91: 964-971, 2001.
21.
Bennett WP, el-Deiry WS, Rush WL, Guinee DG Jr, Freedman AN, Caporaso NE, Welsh JA, Jones
RT, Borkowski A, Travis WD, Fleming MV, Trastek V, Pairolero PC, Tazelaar HD, Midthun D, Jett JR,
Liotta LA and Harris CC. p21waf1/cip1 and transforming growth factor beta 1 protein expression
correlate with survival in non-small cell lung cancer; Clin Cancer Res. 4: 1499-1506, 1998.
22.
Iwasaki A, Kuwahara M, Yoshinaga Y and Shirakusa T. Basic fibroblast growth factor (bFGF) and
vascular endothelial growth factor (VEGF) levels, as prognostic indicators in NSCLC; Eur J Cardiothorac
Surg. 25: 443-448, 2004.
23.
Franklin WA, Veve R, Hirsch FR, Helfrich BA and Bunn PA Jr. Epidermal growth factor receptor
family in lung cancer and premalignancy; Semin Oncol. 29: 3-14, 2002.
24.
Maulik G, Shrikhande A, Kijima T, Ma PC, Morrison PT and Salgia R. Role of the hepatocyte growth
factor receptor, c-Met, in oncogenesis and potential for therapeutic inhibition; Cytokine Growth
Factor Rev. 13: 41-59, 2002.
25.
Vicent S, Garayoa M, López-Picazo JM, Lozano MD, Toledo G, Thunnissen FB, Manzano RG and
Montuenga LM. Mitogen-activated protein kinase phosphatase-1 is overexpressed in non-small
cell lung cancer and is an independent predictor of outcome in patients; Clin Cancer Res. 10: 36393649, 2004.
26.
Vicent S, López-Picazo JM, Toledo G, Lozano MD, Torre W, García-Corchón C, Quero C, Soria
JC, Martín-Algarra S, Manzano RG and Montuenga LM. ERK1/2 is activated in non-small-cell lung
cancer and associated with advanced tumours; Br J Cancer. 90: 1047-1052, 2004.
27.
Garber ME, Troyanskaya OG, Schluens K, Petersen S, Thaesler Z, Pacyna-Gengelbach M, van de
Rijn M, Rosen GD, Perou CM, Whyte RI, Altman RB, Brown PO, Botstein D and Petersen I.
Diversity of gene expression in adenocarcinoma of the lung; Proc Natl Acad Sci U S A. 98: 1378413789, 2001.
28.
Bhattacharjee A, Richards WG, Staunton J, Li C, Monti S, Vasa P, Ladd C, Beheshti J, Bueno R,
Gillette M, Loda M, Weber G, Mark EJ, Lander ES, Wong W, Johnson BE, Golub TR, Sugarbaker
DJ and Meyerson M. Classification of human lung carcinomas by mRNA expression profiling reveals
distinct adenocarcinoma subclasses; Proc Natl Acad Sci U S A. 98: 13790-5, 2001.
29.
Beer DG, Kardia SL, Huang CC, Giordano TJ, Levin AM, Misek DE, Lin L, Chen G, Gharib TG,
Thomas DG, Lizyness ML, Kuick R, Hayasaka S, Taylor JM, Iannettoni MD, Orringer MB and Hanash
S. Gene-expression profiles predict survival of patients with lung adenocarcinoma; Nat Med. 8:
816-24, 2002.
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
105
30.
Hoang CD, D’Cunha J, Tawfic SH, Gruessner AC, Kratzke RA and Maddaus MA. Expression profiling
of non-small cell lung carcinoma identifies metastatic genotypes based on lymph node tumor
burden; J Thorac Cardiovasc Surg. 127: 1332-1341, 2004.
31.
Kobayashi K, Nishioka M, Kohno T, Nakamoto M, Maeshima A, Aoyagi K, Sasaki H, Takenoshita S,
Sugimura H and Yokota J. Identification of genes whose expression is upregulated in lung
adenocarcinoma cells in comparison with type II alveolar cells and bronchiolar epithelial cells in
vivo; Oncogene. 23: 3089-3096, 2004.
32.
Creighton C, Hanash S and Beer D. Gene expression patterns define pathways correlated with
loss of differentiation in lung adenocarcinomas; FEBS Lett. 540: 167-170, 2003.
33.
Kikuchi T, Daigo Y, Katagiri T, Tsunoda T, Okada K, Kakiuchi S, Zembutsu H, Furukawa Y, Kawamura
M, Kobayashi K, Imai K and Nakamura Y. Expression profiles of non-small cell lung cancers on
cDNA microarrays: identification of genes for prediction of lymph-node metastasis and sensitivitycto
anti-cancer drugs; Oncogene. 22: 2192-2205, 2003.
34.
Taxman DJ, MacKeigan JP, Clements C, Bergstralh DT and Ting JP. Transcriptional profiling of targets
for combination therapy of lung carcinoma with paclitaxel and mitogen-activated protein/extracellular
signal-regulated kinase kinase inhibitor; Cancer Res. 63: 5095-104, 2003.
35.
Whiteside MA, Chen DT, Desmond RA, Abdulkadir SA and Johanning GL. A novel time-course
cDNA microarray analysis method identifies genes associated with the development of cisplatin
resistance; Oncogene. 23: 744-52, 2004.
36.
Parmigiani G, Garrett-Mayer ES, Anbazhagan R and Gabrielson E. A cross-study comparison of
gene expression studies for the molecular classification of lung cancer; Clin Can Res. 10: 2922–2927,
2004.
37.
Jiang H, Deng Y, Chen HS,Tao L, Sha Q, Chen J,Tsai CJ and Zhang S. Joint analysis of two microarray
gene-expression data sets to select lung adenocarcinoma marker genes; BMC Bioinformatics. 5: 81,
2004.
38.
Petricoin EF, Ardekani AM, Hitt BA, Levine PJ, Fusaro VA, Steinberg SM, Mills GB, Simone C,
Fishman DA, Kohn EC and Liotta LA. Use of proteomic patterns in serum to identify ovarian
cancer; Lancet. 359: 572-577, 2002.
39.
Yanagisawa K, Shyr Y, Xu BJ, Massion PP, Larsen PH, White BC, Roberts JR, Edgerton M, González
A, Nadaf S, Moore JH, Caprioli RM and Carbone DP. Proteomic patterns of tumour subsets in
non-small-cell lung cancer; Lancet. 362: 433-439, 2003.
40.
Chen G, Gharib TG, Wang H, Huang CC, Kuick R, Thomas DG, Shedden KA, Misek DE, Taylor
JM, Giordano TJ, Kardia SL, Iannettoni MD, Yee J, Hogg PJ, Orringer MB, Hanash SM and Beer DG.
Protein profiles associated with survival in lung adenocarcinoma; Proc Natl Acad Sci U S A. 100:
13537-13542, 2003.
41.
Xiao X, Liu D, Tang Y, Guo F, Xia L, Liu J, He D. Development of proteomic patterns for detecting
lung cancer; Dis Markers. 19: 33-39, 2004.
42.
Meyerson M, Franklin WA and Kelley MJ. Molecular classification and molecular genetics of human
lung cancers; Semin Oncol. 31: 4-19, 2004.
106
Cáncer de pulmón
43.
Kurusu Y, Yamashita J and Ogawa M. Detection of circulating tumor cells by reverse transcriptasepolymerase chain reaction in patients with resectable non-small-cell lung cancer; Surgery. 126: 820826, 1999.
44.
Kimura T, Holland WS, Kawaguchi T, Williamson SK, Chansky K, Crowley JJ, Doroshow JH, Lenz H,
Gandara DR and Gumerlock PH. Mutant DNA in plasma of lung cancer patients: potential for
monitoring response to therapy; Ann.N.Y. Acad. Sci. 1022: 55–60, 2004.
45.
Ramírez JL, Sarriés C, de Castro PL, Roig B, Queralt C, Escuin D, de Aguirre I, Sánchez JM, Manzano
JL, Margeli M, Sánchez JJ, Astudillo J, Taron M and Rosell R. Methylation patterns and K-ras mutations
in tumor and paired serum of resected non-small-cell lung cancer patients; Cancer Lett. 193: 207216, 2003.
46.
Andriani F, Conte D, Mastrangelo T, Leon M, Ratcliffe C, Roz L, Pelosi G, Goldstraw P, Sozzi G
and Pastorino U. Detecting lung cancer in plasma with the use of multiple genetic markers; Int J
Cancer. 108: 91-96, 2004.
47.
Chen XQ, Stroun M, Magnenat JL, Nicod LP, Kur t AM, Lyautey J, Lederrey C and Anker P.
Microsatellite alterations in plasma DNA of small cell lung cancer patients; Nat Med. 2: 10331035, 1996.
48.
Sozzi G, Conte D, León M, Ciricione R, Roz L, Ratcliffe C, Roz E, Cirenei N, Bellomi M, Pelosi G,
Pierotti MA and Pastorino U. Quantification of free circulating DNA as a diagnostic marker in
lung cancer; J Clin Oncol. 21: 3902-3908, 2003.
49.
Sánchez-Céspedes M, Monzó M, Rosell R, Pifarré A, Calvo R, López-Cabrerizo MP and Astudillo
J. Detection of chromosome 3p alterations in serum DNA of non-small-cell lung cancer patients;
Ann Oncol. 9: 113-116, 1998.
50.
Esteller M, Sánchez-Céspedes M, Rosell R, Sidransky D, Baylin SB and Herman JG. Detection of
aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small
cell lung cancer patients; Cancer Res. 59: 67-70, 1999.
51.
Usadel H, Brabender J, Danenberg KD, Jerónimo C, Harden S, Engles J, Danenberg PV, Yang S and
Sidransky D. Quantitative adenomatous polyposis coli promoter methylation analysis in tumor
tissue, serum, and plasma DNA of patients with lung cancer; Cancer Res. 62: 371-375, 2002.
52.
Bearzatto A, Conte D, Frattini M, Zaffaroni N, Andriani F, Balestra D, Tavecchio L, Daidone MG
and Sozzi G. p16(INK4A) hypermethylation detected by fluorescent methylation-specific PCR in
plasmas from non-small cell lung cancer; Clin Cancer Res. 8: 3782-3787, 2002.
53.
Imoto H, Osaki T, Taga S, Ohgami A, Ichiyoshi Y and Yasumoto K. Vascular endothelial growth factor
expression in non-small-cell lung cancer: prognostic significance in squamous cell carcinoma; J
Thorac Cardiovasc Surg.115: 1007-1014, 1998.
54.
Tamura M, Oda M, Tsunezuka Y, Matsumoto I, Kawakami K, Ohta Y and Watanabe G. Chest CT
and serum vascular endothelial growth factor-C level to diagnose lymph node metastasis in patients
with primary non-small cell lung cancer; Chest. 126: 342-346, 2004.
55.
Nieder C, Andratschke N, Jeremic B and Molls M. Comparison of serum growth factors and
tumor markers as prognostic factors for survival in non-small cell lung cancer; Anticancer Res. 23:
5117-5123, 2003.
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
107
56.
Pujol JL, Molinier O, Ebert W, Daures JP, Barlesi F, Buccheri G, Paesmans M, Quoix E, Moro-Sibilot
D, Szturmowicz M, Brechot JM, Muley T and Grenier J. CYFRA 21-1 is a prognostic determinant
in non-small-cell lung cancer: results of a meta-analysis in 2063 patients; Br J Cancer. 90: 20972105, 2004.
57.
Yankelevitz DF, Vázquez M and Henschke CI. Special techniques in transthoracic needle biopsy of
pulmonary nodules; Radiol Clin North Am. 38: 267-279, 2000.
58.
Warner KA, Crawford EL, Zaher A, Coombs RJ, Elsamaloty H, Roshong-Denk SL, Sharief I, Amurao
GV, Yoon Y, Al-Astal AY, Assaly RA, Hernandez DA, Graves TG, Knight CR, Harr MW, Sheridan TB,
DeMuth JP, Zahorchak RJ, Hammersley JR, Olson DE, Durham SJ and Willey JC. The c-myc x E2F1/p21 interactive gene expression index augments cytomorphologic diagnosis of lung cancer in
fine-needle aspirate specimens; J Mol Diagn. 5: 176-183, 2003.
59.
Jeanmart M, Lantuejoul S, Fievet F, Moro D, Sturm N, Brambilla C and Brambilla E. Value of
immunohistochemical markers in preinvasive bronchial lesions in risk assessment of lung cancer;
Clin Cancer Res. 9: 2195-2203, 2003.
60.
Wistuba II, Mao L and Gazdar AF. Smoking molecular damage in bronchial epithelium; Oncogene.
21: 7298-7306, 2002.
61.
McWilliams A, Mayo J, MacDonald S, leRiche JC, Palcic B, Szabo E and Lam S. Lung cancer screening:
a different paradigm; Am J Respir Crit Care Med. 168: 1167-1173, 2003.
62.
Henschke CI. Medicine on lung cancer screening. A Different Paradigm; Am J Respir Crit Care Med.
168: 1143-1143, 2003.
63.
Field JK and Liloglou T. Fluorescent microsatellite analysis in bronchial lavage as a potential diagnostic
tool for lung cancer; Methods Mol Med. 75: 251-262, 2003.
64.
Carstensen T, Schmidt B, Engel E, Jandrig B, Witt C and Fleischhacker M. Detection of cell-free
DNA in bronchial lavage fluid supernatants of patients with lung cancer; Ann N Y Acad Sci. 1022:
202-210, 2004.
65.
Kim H, Kwon YM, Kim JS, Lee H, Park JH, Shim YM, Han J, Park J and Kim DH. Tumor-specific
methylation in bronchial lavage for the early detection of non-small-cell lung cancer; J Clin Oncol.
22: 2363-2370, 2004.
66.
Topaloglu O, Hoque MO, Tokumaru Y, Lee J, Ratovitski E, Sidransky D and Moon CS. Detection
of promoter hypermethylation of multiple genes in the tumor and bronchoalveolar lavage of
patients with lung cancer; Clin Cancer Res. 10: 2284-2288, 2004.
67.
Grote HJ, Schmiemann V, Kiel S, Bocking A, Kappes R, Gabbert HE and Sarbia M. Aberrant
methylation of the adenomatous polyposis coli promoter 1A in bronchial aspirates from patients
with suspected lung cancer; Int J Cancer. 110: 751-755, 2004.
68.
Thunnissen FB. Sputum examination for early detection of lung cancer; J Clin Pathol. 56: 805-810,
2003.
69.
Frost JK, Ball WC Jr, Levin ML, Tockman MS, Baker RR, Carter D, Eggleston JC, Erozan YS, Gupta
PK, Khouri NF, et al. Early lung cancer detection: results of the initial (prevalence) radiologic and
cytologic screening in the Johns Hopkins study; Am Rev Respir Dis. 130: 549-554, 1984.
108
Cáncer de pulmón
70.
Prindiville SA, Byers T, Hirsch FR, Franklin WA, Miller YE, Vu KO, Wolf HJ, Baron AE, Shroyer KR,
Zeng C, Kennedy TC and Bunn PA. Sputum cytological atypia as a predictor of incident lung
cancer in a cohort of heavy smokers with airflow obstruction; Cancer Epidemiol Biomarkers Prev.
12: 987-993, 2003.
71.
Kennedy TC, Miller Y and Prindiville S. Screening for lung cancer revisited and the role of sputum
cytology and fluorescence bronchoscopy in a high-risk group; Chest; 117: 72S-79S, 2000.
72.
Marek W, Kotschy-Lang N, Muti A, Kohler CH, Nielsen L, Topalidis TH, Atay Z and Nakhosteen
JA. Can semi-automated image cytometry on induced sputum become a screening tool for lung
cancer? Evaluation of quantitative semi-automated sputum cytometry on radon- and uraniumexposed workers; Eur Respir J. 18: 942-950, 2001.
73.
Tockman MS, Mulshine JL, Piantadosi S, Erozan YS, Gupta PK, Ruckdeschel JC, Taylor PR, Zhukov
T, Zhou WH, Qiao YL and Yao SX. Prospective detection of preclinical lung cancer: results from
two studies of hnRNP A2/B1 overexpression; Clin Cancer Res. 3: 2237-2246, 1997.
74.
Sueoka E, Goto Y, Sueoka N, Kai Y, Kozu T and Fujiki H. Heterogeneous nuclear ribonucleoprotein
B1 as a new marker of early detection for human lung cancers; Cancer Res. 59: 1404-1407, 1999.
75.
Mao L, Hruban RH, Boyle JO, Tockman M and Sidransky D. Detection of oncogene mutations in
sputum precedes diagnosis of lung cancer; Cancer Res. 54: 1634-1637, 1994.
76.
Kersting M, Friedl C, Kraus A, Behn M, Pankow W and Schuermann M. Differential frequencies of
p16(INK4a) promoter hypermethylation, p53 mutation, and K-ras mutation in exfoliative material
mark the development of lung cancer in symptomatic chronic smokers; J Clin Oncol. 18: 32213229, 2000.
77.
Somers VA, Pietersen AM, Theunissen PH, Thunnissen FB. Detection of K-ras point mutations in
sputum from patients with adenocarcinoma of the lung by point-EXACCT; J Clin Oncol. 16: 30613068, 1998.
78.
Palmisano WA, Divine KK, Saccomanno G, Gilliland FD, Baylin SB, Herman JG and Belinsky SA.
Predicting lung cancer by detecting aberrant promoter methylation in sputum; Cancer Res. 60:
5954-5958, 2000.
79.
Belinsky SA, Palmisano WA, Gilliland FD, Crooks LA, Divine KK, Winters SA, Grimes MJ, Harms
HJ, Tellez CS, Smith TM, Moots PP, Lechner JF, Stidley CA and Crowell RE. Aberrant promoter
methylation in bronchial epithelium and sputum from current and former smokers; Cancer Res.
62: 2370-7, 2002.
80.
Phillips M, Cataneo RN, Cummin AR, Gagliardi AJ, Gleeson K, Greenberg J, Maxfield RA and Rom
WN. Detection of lung cancer with volatile markers in the breath; Chest. 123: 2115-2123, 2003.
81.
Gessner C, Kuhn H, Toepfer K, Hammerschmidt S, Schauer J, Wirts H. Detection of p53 gene
mutations in exhaled breath condensate of non-small cell lung cancer patients; Lung Cancer. 43:
215-222, 2004.
82.
Fiegl M, Massoner A, Haun M, Sturm W, Kaufmann H, Hack R, Krugmann J, Fritzer-Szekeres M,
Grunewald K and Gastl G. Sensitive detection of tumour cells in effusions by combining cytology
and fluorescence in situ hybridisation (FISH); Br J Cancer. 91: 558-563, 2004.
Búsqueda de marcadores moleculares para la detección precoz del cáncer de pulmón
109
83.
Romeo MS, Sokolova IA, Morrison LE, Zeng C, Baron AE, Hirsch FR, Miller YE, Franklin WA and
Varella-García M. Chromosomal abnormalities in non-small cell lung carcinomas and in bronchial
epithelia of high-risk smokers detected by multi-target interphase fluorescence in situ hybridization;
J Mol Diagn. 5: 103-112, 2003.
84.
Zhukov TA, Johanson RA, Cantor AB, Clark RA and Tockman MS. Discovery of distinct protein
profiles specific for lung tumors and pre-malignant lung lesions by SELDI mass spectrometry; Lung
Cancer. 40: 267-279, 2003.
85.
Brambilla C, Fievet F, Jeanmart M, de Fraipont F, Lantuejoul S, Frappat V, Ferretti G, Brichon PY
and Moro-Sibilot D. Early detection of lung cancer: role of biomarkers; Eur Respir J Suppl. 39: 36S44S, 2003.
86.
Hilbe W, Dlaska M, Duba HC, Dirnhofer S, Eisterer W, Oberwasserlechner F, Mildner A, Schmid
T, Kuhr T and Woll E. Automated real-time PCR to determine K-ras codon 12 mutations in nonsmall cell lung cancer: comparison with immunohistochemistry and clinico-pathological features;
Int J Oncol. 23: 1121-1126, 2003.
87.
Field JK, Brambilla C, Caporaso N, Flahault A, Henschke C, Herman J, Hirsch F, Lachmann P, Lam
S, Maier S, Montuenga LM, Mulshine J, Murphy M, Pullen J, Spitz M, Tockman M, Tyndale R, Wistuba
I and Youngson J. Consensus statements from the Second International Lung Cancer Molecular
Biomarkers Workshop: a european strategy for developing lung cancer molecular diagnostics in
high risk populations; Int J Oncol. 21: 369-73, 2002.
88.
Petty RD, Nicolson MC, Kerr KM, Collie-Duguid E and Murray GI. Gene expression profiling in
non-small cell lung cancer: from molecular mechanisms to clinical application; Clin Cancer Res. 10:
3237-48, 2004.
110
Cáncer de pulmón
FACTORES PRONÓSTICOS
EN CÁNCER DE PULMÓN
Ángel López-Encuentra
Hospital Universitario 12 de Octubre
Madrid
Contenido:
Resumen de la ponencia
Bibliografía
Artículos del ponente
Factores pronósticos en cáncer de pulmón
Ángel López Encuentra
Servicio Neumología
Hospital Universitario 12 de Octubre, Madrid
Introducción
En Cáncer de Pulmón (CP) interesan diversos pronósticos como puede ser el de supervivencia global,
el de supervivencia específica por cáncer, el de calidad de vida durante supervivencia, el de respuesta
o resistencia terapéutica. Los más estudiados son los factores pronósticos (FP) de supervivencia, global
o específica para CP.
Revisiones recientes sobre este tema han detectado que la mayoría de los estudios publicados
sobre FP en CP tienen baja potencia estadística y son marcadamente heterogéneos.
Tipos de factores pronósticos
En CP se consideran tres tipos de FP. En primer lugar los más clásicos relacionados con la extensión
anatómica tumoral y que están contenidos en la clasificación TNM ampliamente conocida.
Otra fuente de FP potenciales son los factores clínicos relacionados con el huésped del tumor,
por las propias características del paciente o por la interacción entre enfermedad y enfermo.
Finalmente, una fundada esperanza: que los posibles FP de Biología Molecular mejoren la capacidad
predictiva pronóstica de los otros dos tipos de FP referidos.
Clasificación de extensión anatómica TNM-estadios
Cada estadio en la clasificación de 1997 está compuesto de una serie de combinaciones entre los
apartados T, N y M, y cada uno de estos apartados contienen diversos componentes agrupados (tamaño,
invasión de estructuras locales concretas, etc.).
Por tanto, la unidad clasificatoria inicial es la presencia de elementos individuales, como el tamaño
tumoral, que, agrupados con otros elementos, van conformando una escala clasificatoria ascendente y
reduccionista.
La última clasificación TNM de 1997 está validada en su aspectos más groseros como son los
estadios patológicos en las fases más iniciales del CB.
Sin embargo, hay diversos problemas en la clasificación TNM. La estadificación patológica, que es
la más exacta a nivel pronóstico, exige la presencia de pieza quirúrgica del tumor extirpado. Esta situación
sólo ocurre en alrededor de un 20% de todos los CP diagnosticados. La estadificación TNM clínica (la
que no se efectúa con los datos de la pieza extirpada en toracotomía) tiene una baja certeza clasificatoria
cuando se compara con la prueba de referencia (gold standard), que es la TNM patológica.
También, la clasificación TNM de 1997, tiene algunos parámetros como es el tamaño tumoral con
baja capacidad discriminativa para pronóstico al utilizar únicamente una escala dicotómica (igual-menor,
o mayor de 3 cm), disminuyendo su capacidad para establecer un mayor abanico de pronósticos.
Se prevé que para el año 2007 se efectúe una propuesta de nueva clasificación TNM para el
CP al evaluar una base de datos de más de 50.000 pacientes.
Factores pronósticos en cáncer de pulmón
113
Factores pronósticos clínicos
Cuando se analizan las curvas de supervivencia del CP, aun en los mejores casos de estirpe no microcítica
resecados curativos y en estadios iniciales (estadio I p) se observa que la clasificación de extensión
anatómica es insuficiente como escala pronostica para predecir a los supervivientes a largo plazo.
Existen numerosos estudios que observan que diversos factores clínicos intervienen de forma
independiente en el pronóstico. Entre las determinaciones de laboratorio están los niveles de calcio, de
la hemoglobina, de la LDH, de la albúmina. Entre los datos clínicos, la pérdida de peso, el estado clínico
general (PS), el sexo, la edad o la presencia de síntomas.
Un “índice clínico”, que agrupa diferentes condiciones de la clínica o de las determinaciones
bioquímicas, no parece discriminar pronóstico cuando se analiza en la población CP no microcítica
resecados completos y en estadios iniciales. Sin embargo, un “índice de comorbilidad”, que considera
diversas enfermedades, asociadas, si parece comportarse como un factor pronóstico independiente en
todas las poblaciones de CP quirúrgico, inclusive en los tumores más pequeños de igual o menos de
2 cm de tamaño en pieza quirúrgica. Este efecto de la comorbilidad se detecta, fundamentalmente en
el grupo de edad mas joven.
Algunas enfermedades asociadas, como es la enfermedad pulmonar obstructiva crónica, sólo tienen
impacto pronóstico cuando se analiza este factor en forma de supervivencia condicional tras 2 ó 3
años vivo desde la cirugía.
Cuando se han considerado diferentes metodologías de análisis multivariable combinando factores
pronósticos de extensión anatómica TNM con factores pronósticos clínicos, el área bajo la curva ROC
para predicción de pronóstico a 3 años no es superior a 0,72. Ello implica que existe un margen, aun
importante, para la mejora predictiva del pronóstico en CP. ¿Los factores pronósticos derivados de los
estudios de genómica y proteómica pueden ayudar a esa mejora?
Factores pronósticos de biología molecular
Existen suficientes datos para afirmar que los FP de Biología Molecular (BM) pueden mejorar, y en
ocasiones sustituir, la predicción de pronóstico de supervivencia hasta ahora conocida con los parámetros
TNM y los clínicos.
Sin embargo, tras un período inicial de aparentes avances significativos, el mejor conocimiento de
la BM en CP ha demostrado su complejidad y la necesidad de disponer de cuatro tecnologías básicas:
una base clínica de datos controlados, un análisis masivo de genes o de proteínas (arrays), un conocimiento
y manejo adecuado variable por variable (análisis uni y multivariable), y una excelente organización,
gestión y coordinación de todos los aspectos multidisciplinarios y multicéntricos que estos estudios
precisan.
Conclusiones
Actualmente existe un numeroso grupo de investigadores que intentan mejorar el conocimiento de los
factores pronósticos (FP) en el cáncer de pulmón (CP).
En primer lugar, y por primera vez en la historia de la estadificación, actualmente se está manejando
la información de más de 50.000 pacientes provenientes de todo el mundo a fin de producir una nueva
clasificación TNM para esta enfermedad en 2007.
En segundo lugar, en supervivencia global, ciertos factores clínicos en una población con CP, con
una edad media cada vez más avanzada, son FP independientes como es la presencia de la comorbilidad.
114
Cáncer de pulmón
Finalmente, todas las limitaciones aprendidas en la construcción de clasificaciones tumorales
pronósticas son lecciones útiles para manejar, de forma integrada, la nueva fuente de información
predictiva que es la Biología Molecular.
Ciertos requerimientos deben de ser cubiertos para que esa posibilidad pueda confirmarse de
forma consistente.
Bibliografía
1.
Buccheri G, Ferrigno D. Prognostic factors. Hematol Oncol Clin North Am 2004; 18: 187-201.
2.
Buccheri G, Ferrigno D. Prognostic factors in lung cancer: tables and comments. Eur Respir J
1994; 7: 1350-64.
3.
Brundage MD, Davies D, Mackillop WJ. Prognostic factors in non-small cell lung cancer: a decade
of progress. Chest 2002; 122: 1037-57.
4.
Gospodarowicz MK, Henson DE, Hutter RVP, O´Sullivan B, Sobin LH, Wittekind Ch (eds). Prognostic
Factors in Cancer. UICC. Wilwy Liss. New York. 2001.
5.
Sánchez-Céspedes M. Dissecting the genetic alterations involved in lung carcinogenesis. Lung
Cancer 2003; 40: 111-21.
6.
Sánchez-Céspedes M. Pronóstico biológico y farmacogenómica. Congreso Nacional SEPAR. Junio
2004. URL (disponible septiembre 2004): www.separ.es (Oncología / Reuniones).
7.
Fong KM, Minna JD. Molecular biology of lung cancer: clinical implications. Clin Chest Med 2002;
23: 83-101
8.
Driscoll B (ed). Methods in Molecular Medicine. Lung Cancer. Diagnostic and Therapeutic Methods
and Reviews. Volumen II. Humana Press. New Jersey. 2003.
9.
Yanagisawa K, Shyr Y, Xu BJ, Massion PP, Larsen PH, White BC, Roberts JR, Edgerton M, Gonzalez A,
Nadaf S, Moore JH, Caprioli RM, Carbone DP. Proteomic patterns of tumour subsets in nonsmall-cell lung cancer. Lancet 2003; 362: 33-9.
10.
Fong KM, Sekido Y, Gazdar AF, Minna JD. Lung cancer. 9: Molecular biology of lung cancer: clinical
implications. Thorax 2003; 58: 892-900.
11.
Kallioniemi OP, Wagner U, Kononen J, Sauter G. Tissue microarray technology for high-throughput
molecular profiling of cancer. Hum Mol Genet 2001; 10: 657-62
12.
Petty RD, Nicolson MC, Kerr KM, Collie-Duguid E, Murray GI. Gene expression profiling in nonsmall cell lung cancer: from molecular mechanisms to clinical application. Clin Cancer Res 2004;
10: 3237-48.
13.
Fernando HC, Goldstraw P. The accuracy of clinical evaluative intrathoracic staging in lung cancer
as assessed by postsurgical pathologic staging. Cancer 1990; 65: ≠2503-6.
Factores pronósticos en cáncer de pulmón
115
14.
López-Encuentra, A, García-Luján R, Rivas JJ, Rodríguez-Rodríguez J, Torres-Lanza J, Varela-Simo G;
and Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and
Thoracic Surgery (GCCB-S). Comparison between clinical and pathological staging in 2,994 cases
of lung cancer. Ann Thorac Surg 2004 (en prensa).
15.
Lopez-Encuentra A, Bulzebruck H, Feinstein AR, Motta G, Mountain CF, Naruke T, Sanchez JM,
Tsuchiya R, Wittekind C. Tumor staging and classification in lung cancer. Lung Cancer 2000;
29: 79-83.
16.
Clinical tumour size and prognosis in lung cancer. Bronchogenic Carcinoma Cooperative Group of
the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Eur Respir J 1999; 14: 812-6.
17.
Lopez-Encuentra A, Duque-Medina JL, Rami-Porta R, de la Camara AG, Ferrando P; Bronchogenic
Carcinoma Co-operative Group of the Spanish Society of Pneumology and Thoracic Surgery.
Staging in lung cancer: is 3 cm a prognostic threshold in pathologic stage I non-small cell lung
cancer? A multicenter study of 1,020 patients. Chest 2002; 121: 1515-20.
18.
Lopez-Encuentra A; Bronchogenic Carcinoma Co-operative Group. Comorbidity in operable lung
cancer: a multicenter descriptive study on 2992 patients. Lung Cancer 2002; 35: 263-9.
19.
Tammemagi CM, Neslund-Dudas C, Simoff M, Kvale P. In lung cancer patients, age, race-ethnicity,
gender and smoking predict adverse comorbidity, which in turn predicts treatment and survival.
J Clin Epidemiol 2004; 57: 597-609.
20.
Janssen-Heijnen ML, Smulders S, Lemmens VE, Smeenk FW, van Geffen HJ, Coebergh JW. Effect
of comorbidity on the treatment and prognosis of elderly patients with non-small cell lung cancer.
Thorax 2004; 59: 602-7.
21.
Iizasa T, Suzuki M,Yasufuku K, Iyoda A, Otsuji M,Yoshida S, Sekine Y, Shibuya K, Saitoh Y, Hiroshima K,
Fujisawa T. Preoperative pulmonary function as a prognostic factor for stage I non-small cell lung
carcinoma. Ann Thorac Surg 2004; 77: 1896-902
22.
Gomez de la Cámara A, López-Encuentra A, Ferrando P and Bronchogenic Carcinoma Cooperative Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). Heterogeneity
of prognostic profiles in non-small cell lung cancer. J Clin Epidemiol 2004 (enviado para publicación)
116
Cáncer de pulmón
Staging in Lung Cancer: Is 3 cm a
Prognostic Threshold in Pathologic
Stage I Non-small Cell Lung Cancer?
A Multicenter Study of 1,020 Patients
Ángel López-Encuentra, MD, PhD; José Luis Duque-Medina, MD, PhD;
Ramón Rami-Porta, MD, PhD; Agustı́n Gómez de la Cámara, MD, PhD;
Paloma Ferrando, MSc; for the Bronchogenic Carcinoma Co-operative Group of
the Spanish Society of Pneumology and Thoracic Surgery†
Introduction: Since 1974, a tumor size of 3 cm in diameter has been regarded as the prognostic
threshold in the staging of bronchogenic carcinoma.
Objective: To study the prognostic behavior of surgical-pathologic tumor size in non-small cell
lung cancer (NSCLC) with complete resection.
Design: Four-year multi-institutional prospective study from 1993 to 1997.
Patients: Consecutive cases of NSCLC in pathologic stages IA-IB (pIA-pIB) treated surgically with
complete resection in hospitals belonging to the Bronchogenic Carcinoma Co-operative Group of
the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S).
Methods: The Schoenfeld procedure was used to identify different prognostic groups, considering
1 cm as the measurement unit.
Results: Based on the 1,020 cases evaluated, four prognostic groups were identified: 0 to 2 cm
(group A; n ⴝ 147), 2.1 to 4 cm (group B; n ⴝ 448), 4.1 to 7 cm (group C; n ⴝ 336), and > 7 cm
(group D; n ⴝ 89). At 5 years, survival was 0.63 (95% confidence interval [CI], 0.58 to 0.68), 0.56
(95% CI, 0.53 to 0.59), 0.49 (95% CI, 0.46 to 0.52), and 0.38 (95% CI, 0.32 to 0.44) for groups A,
B, C, and D, respectively. Differences between paired groups (log-rank) were significant: 0.0074
between groups A and B, 0.0048 between groups B and C, and 0.0034 between groups C and D.
Conclusions: In initial stages (pIA-pIB) of NSCLC, the 3-cm value was not found to behave
as a prognostic threshold; in this study, four surgical-pathologic tumor size groups were
identified with strong prognostic differences: from 0 to 2 cm, from 2.1 to 4 cm, from 4.1 to 7 cm,
and > 7 cm.
(CHEST 2002; 121:1515–1520)
Key words: lung cancer; lung neoplasms; size; surgery
Abbreviations: CI ⫽ confidence interval; GCCB-S ⫽ Bronchogenic Carcinoma Co-operative Group of Spanish Society
of Pneumology and Thoracic Surgery; NSCLC ⫽ non-small cell lung cancer
ince 1974, 3 cm has been regarded as the only
S tumor
size to establish a prognostic threshold in
1
the staging of bronchogenic carcinoma. Even though
the staging classification has been updated repeat*From Hospital Universitario (Dr. Duque-Medina), Valladolid;
Hospital Universitario 12 de Octubre (Drs. López-Encuentra and
de la Cámara, and Ms. Ferrando), Madrid; and Hospital Mutua
de Terrassa (Dr. Rami-Porta), Barcelona, Spain.
†A complete list of GCCB-S members is given in the Appendix.
Partly financed by FIS grant 97/0011, FEPAR-1995 grant,
Fundación RESPIRA-2000 grant, and financial aid from CastillaLeón regional government and Menarini Foundation.
Manuscript received July 2, 2001; revision accepted November
14, 2001.
Correspondence to: Angel López-Encuentra, MD, FCCP, Pneumology Service, Hospital Universitario 12 de Octubre, Ctta.
Andalucı́a 5.4, 28041 Madrid, Spain; e-mail: lencuent@h12o.es
www.chestjournal.org
edly (the last update being in 1997),2 criteria for
tumor size has remained unchanged for the last 25
years.
There is a need to conduct further research on
other clinical or molecular biological prognostic factors in patients with lung cancer; therefore, it becomes essential for the basic anatomic classification
of tumors to be founded on solid grounds. A new
prognostic factor could only be considered useful,
and included as part of the tumor classification, if it
has the ability to modify the prediction and accuracy
of the TNM anatomic classification.3
The TNM classification is simplified to make its
use easier; however, that simplicity may lead to
decreased prognostic certainty or, in other words, a
CHEST / 121 / 5 / MAY, 2002
1515
loss of prognostic discrimination. Repeatability or
validation of the prognostic values for the main
pathologic stages in a surgical population with nonsmall cell lung cancer (NSCLC) has been demonstrated in the United States, Japan, Germany, and
Spain.4 Nonetheless, and as it was to be expected, it
has now been acknowledged that the consideration
of TNM descriptors was more predictive of prognosis than the assessment of tumor stages.5
The Bronchogenic Carcinoma Co-operative Group
of the Spanish Society of Pneumology and Thoracic
Surgery (GCCB-S) has recently evaluated its experience in the prognostic analysis of prethoracotomy
clinical tumor size in lung cancer.6 This study was able
to identify four different prognostic groups of tumor
size based on radiography. However, since this clinical
staging was based on a population that in the end
required surgery, it involved some problems: the
greater the tumor size, the greater the probability to
have invaded mediastinal lymph nodes at thoracotomy,
even in cases of small NSCLC; or the higher frequency
of exploratory thoracotomies or incomplete resections
in larger tumors, among other limitations.7–10 The goal
of this study is to evaluate tumor size as a prognostic
factor in patients with pT1-T2N0M0 NSCLC undergoing complete resection in a nonselected surgical
population.
Materials and Methods
The surgical-pathologic size was obtained by measuring the
greatest diameter of the fresh surgical specimen.
Surgical-pathologic stage N0 was assigned when there was no
lymph node involvement after systematic nodal dissection or
when sampling of at least four lymph node stations was performed (stations 2, only on the right side, 4, 7, and 10 ipsilateral
to the tumor).13 These criteria were similar to those proposed in
recent recommendations,14 such as the need to obtain six hilarmediastinal lymph nodes, in order to define pN0. For the
purpose of classifying the presence or absence of mediastinal
lymph node involvement, a randomized study15 demonstrated
that sampling had a value similar to that of mediastinal lymph
node dissection. The GCCB-S operational definition for standard
complete resection requires the absence of tumor involvement of
resection margins, extracapsular involvement of resected mediastinal lymph nodes, positive biopsy finding in unresected mediastinal lymph nodes, and the absence of tumor pleural effusion.
Internal and external audits were performed to review the ratio
between the number of patients undergoing surgery and the
number of cases included in the GCCB-S Registry (standard
⬎ 95%), and to review the presence and validity of the data
collected and recorded for each case (standard ⬎ 75%), including
the consistency of tumor staging. The criterion for the validity of
survival data was established on the existence of a known
follow-up of, at least, 85% of the case-patients registered in each
hospital. In the hospitals that did not meet all these conditions,
the cases corresponding to the anomalous period were excluded.
Finally, correct data transmission from the paper record to the
computer database was verified on two separate occasions.
These procedures were designed to control the following
aspects: selection bias of surgical cases, registered cases over the
total number of surgical cases, sample size, type of hospital,
prognostic migration due to the prolonged period of case recruitment, classification with low or deficient degrees of certainty,
contamination by data from incomplete series or erroneous data,
and loss of adequate long-term follow-up.
Study Subjects
Analysis
All the patients included prospectively in this study had
NSCLC in initial stages (pIA-pIB) and underwent thoracotomy
with complete resection in hospitals pertaining to the GCCB-S11
between October 1993 and September 1997, both inclusive.
Similar criteria for the functional operability of patients and
oncologic operability of the tumor were used in all the GCCB-S
hospitals.12 The participating GCCB-S centers had a wide variety
of activities, including a representative range of number of beds,
type of activity (university and nonuniversity, community, public,
and private ownership), and number of interventions per year
(range, 8 to 100 interventions). The sample was complete, as
verified by the inclusion in the registry of all patients undergoing
complete surgical resection. Patients with death due to operative
mortality or patients receiving neoadjuvant therapy were excluded from the analysis. The total number of NSCLC patients
operated on with any pathologic stage and any type of surgery was
2,300. The final number of cases included in this study was 1,020.
Data were collected prospectively, in real-time, over the 4-year
study period, using a unified single self-copying form that
included the original and a copy (the original form was filed at the
hospital and a copy omitting affiliation data was sent to the
GCCB-S headquarters). At the GCCB-S Registry, each classificatory component for the different T categories (tumor size,
pleural tumor involvement, or tumor involvement of other
endothoracic structures) was considered differently and on an
individual basis for each patient. The diagnostic procedure
employed was marked using a previously agreed-on code and the
procedure showing the best resolution recorded in the registry.
Tumor size has been analyzed in different studies16,17 using
different methods and perspectives. Notwithstanding, it is a
known fact that compilation of observations of supposedly continuous variables is bound to include errors that affect both the
accuracy and validity of such estimations. The terminal digit
preference phenomenon and rounding up have been cited as
typical examples.18,19 The statistical reliability, the way the variable is distributed, and the accurate classification of the study
subjects can be seriously affected as a result of this phenomenon.
This study verified the distribution of the tumor size variable in
order to choose the best method of analysis by observing the
mentioned digit preference.
A distribution of absolute and relative frequencies of pathologic tumor size was performed, and the normality of such
distribution of data subsequently analyzed using the ShapiroWilks method. The Schoenfeld procedure20 was used to identify
prognostic tumor size intervals. In this procedure, the continuous
variable of tumor size was reclassified arbitrarily into intervals
(centimeters in this case). A series of consecutive intervals was
generated and its correlation with survival confirmed statistically
using the Cox proportional risk procedure,21 which revealed the
magnitude of the relative risk of each stratum.
Different survival outcomes at various periods of time were
analyzed and 95% confidence intervals (CIs) calculated using life
tables (actuarial survival); survival curves were compared using
the log-rank method. Statistical significance was adjusted using
the Bonferroni correction for paired comparisons between
strata.22
1516
Clinical Investigations
Results
Distribution of Tumor Size Data
Figure 1 shows the histogram of pathologic tumor
size, where those population subjects with a tumor
size of ⱕ 7 cm were selected, clearly showing the
discontinuity and nonnormality behavior displayed
by this variable. This is why the Schoenfeld procedure was used for analysis.
Population Characteristics
Of the 1,020 patients that comprised this series,
945 patients (93%) were men. Mean (SD) age was
64.1 (8.85) years (range, 36 to 87 years). By histologic
typing of the surgical specimen, 607 tumors (60%)
were epidermoid, 180 tumors (18%) were large cell,
136 tumors (13%) were adenocarcinomas, and the
remaining 97 tumors (9%) were of an undefined type
or a mixture of the previously mentioned types.
Prognosis According to Pathologic Tumor Size
Mean pathologic tumor size was 4.27 cm (SD, 2.2
cm; median, 4 cm; range, 0.4 to 15 cm). Table 1
shows the four prognostic intervals yielded by the
Schoenfeld procedure20 and the Cox procedure.21
Figure 2 shows a graphic representation of the four
survival curves for each prognostic stratum according
to the pathologic tumor size.
Discussion
This study comprised a large series collected in a
short and recent time period. The study was multi-
Figure 1. Frequency distribution of pathologic tumor size (in
centimeters). Data corresponding to tumors ⱕ 7 cm in diameter
are presented. A digit preference is detected in whole values and
in their halves (1 cm, 1.5 cm, 2 cm, 2.5 cm, etc.).
www.chestjournal.org
institutional and representative of cases of NSCLC
treated surgically in Spain, with an initial design
conceived to control the usual bias in prognostic
and/or therapeutic studies. Even though, based on
the pathologic stage, similar survival rates are seemingly reported in different experiences,4 those aspects of the methodology are particularly important
in view of the variations in survival reported by
different series for the same prognostic TNM categories in NSCLC.23
This prospective multi-institutional analysis conducted by the GCCB-S between 1993 and 1997
included a prognosis-specific analysis of pathologic
tumor size in 1,020 pIA-pIB NSCLC patients who
underwent a complete resection. The analyses conducted point to the existence, in this population of
subjects whose initial NSCLC was treated, of four
different prognostic groups distributed according to
tumor size; the 3-cm value is not a threshold of
prognostic significance. The pathologic tumor size
intervals yielded by this study (0 to 2 cm, 2.1 to 4 cm,
4.1 to 7 cm, and ⬎ 7 cm) are identical to those
observed by our group6 for the analysis of clinical
tumor size although, evidently, with different survival values.
In resected pathologic stage I NSCLC, with a
surgical specimen of 4.1 to 7 cm, survival at 4 and 5
years of 0.53 and 0.49, respectively (our study), is
worse than the survival specified for pathologic stage
IIA (0.61 and 0.55, respectively).16 For tumors
⬎ 7 cm, the prognosis at 2, 3, 4, and 5 years (0.51.
0.45, 0.41, and 0.38, respectively) is identical to that
reported for descriptors pT2N1M0-pT3N0M0 (stage
IIB) [0.56, 0.46, 0.42, and 0.39, respectively].16
Comparison between this GCCB-S series and that
published by Mountain16 in 1997 seems adequate, as
both these series refer, in terms of pathologic staging, to NSCLC cases with complete resection, and
both exclude operative mortality. In these last few
years, there has been regained interest for the early
screening and detection of lung cancer, due in part
to the availability of procedures such as low-radiation
CT for detection of small nodules.24 Besides the
controversy raised by the design of population
screening research studies, contradictory data have
been identified regarding prognosis within the
different magnitudes in T1N0M0 lung cancer
(ⱕ 3 cm). One report17 describes experiences that
do not indicate prognostic differences among tumors
of ⬍ 3 cm; however, another study25 found such
differences. Editorials26 and letters27 continue to
fuel this current controversial issue.
Ten years ago, Watanabe et al28 considered a 5-cm
diameter to be a prognostic threshold for tumor size.
He then proposed that category T2 be divided into
two groups (a and b), depending on whether the
CHEST / 121 / 5 / MAY, 2002
1517
Table 1—Risk Ratio (Death) and Survival According to Different Strata of Pathologic Tumor Size
Groups
A
B
C
D
Tumor Size
Diameter, cm
0–2
2.1–4
4.1–7
⬎7
No.
2
3
4
5
Log Rank
147
448
336
89
1
1.5 (1.1–2.2)
2.1 (1.5–3.1)
3.5 (2.3–5.4)
0.90
0.81
0.71
0.51
0.83
0.71
0.61
0.45
0.76
0.65
0.53
0.41
0.63
0.56
0.49
0.38
0.0074
0.0048
0.0034
tumor was above or below that diameter.28 One
study29 evaluated the risk ratio for recurrence, taking
into account the centimeters of the tumor. That risk
ratio was 1.2 per centimeter (95% CI, 1.1 to 1.4).
Some European series30 on surgical lung cancer of
a predominantly squamous type (57%), and with the
majority of patients being male (63%), have conducted a prognostic analysis on various strata of
tumor size. When a size of ⱕ 2 cm was taken as
reference, strata of ⱕ 4 and ⬎ 4 cm were shown to
have a direct correlation with survival. Finally, other
analyses have considered the magnitude of estimated
tumor volume in NSCLC stages I and II.31 The
death risk increases in line with tumor volume for
each of the stages, in a significant and independent
fashion. The Schoenfeld procedure used in our study
affords the advantages, in this type of tumor size
analysis, of examining progressive changes in the dependent variable (survival), depending on the levels of
the independent variable (tumor size), enabling delimitation of critical borderlines in which substantial
changes in such dependent variable may occur.
Our study may have certain limitations and a
specific reproducibility problem attached to it. The
pathologic tumor size was obtained by measuring the
Figure 2. Survival in NSCLC in stage pIA-B with complete
resection (n ⫽ 1,020) according to pathologic (p) tumor size.
cum ⫽ cumulative.
1518
Survival, yr
Risk Ratio
(95% CI)
actual surgical specimen. A possible problem with a
double implication could be the presence of accompanying atelectasis or pneumonitis. Since atelectasis
or pneumonitis is more likely to appear in large
tumors, and such clinical picture is another criterion
for T2,16 the combination of these two factors could
worsen the prognosis. In addition, such association
could wrongly overestimate the presumed size of the
tumor. In the present study, the frequency of surgical-pathologic atelectasis or pneumonitis, as measured in the four mentioned tumor strata, was 22%,
23%, 29%, and 21% for groups A, B, C, and D (Table
1), respectively.
In a previous GCCB-S study6 on prognostic analysis of clinical tumor size, cases with visceral pleural
involvement were excluded. In this study (1,020
patients with pIA-pIB), the presence or absence of
visceral pleural involvement does not modify prognosis in the different pathologic tumor size strata.
For instance, survival at 3 years for tumor groups A,
B, C, and D (Table 1) was 0.83, 0.72, 0.61, and 0.42,
respectively, if there was no visceral pleural involvement. If, however, there was visceral pleural involvement, survival at 3 years for the same groups was
0.93, 0.68, 0.60, and 0.51, respectively. Other
groups5,32 report similar experiences. Other classificatory or definer components for T2, such as proximal bronchial involvement, do not appear to add any
prognostic value to tumor size.25
Our population may be regarded as representative
of NSCLC in stage pIA-pIB with complete resection
in Spain in view of the multi-institutional nature of
the GCCB-S, the magnitude of our sample, and
quality controls undertaken. Nonetheless, given that
the majority of our patients in our study were male
with an epidermoid type of tumor, with scarce
presentation of adenocarcinoma, and infrequent
bronchioalveolar carcinomas, extrapolating our experience to other communities (the United States or
Japan) might be somewhat problematic.
Based on our criteria, and on the data shown in the
evaluation of clinical tumor size for a surgical population and for pathologic tumor size, the prognostic
groups observed must be taken into account when
evaluating any new potential prognostic factor (bioClinical Investigations
logical, clinical, molecular, etc.) or when designing
stratification criteria in clinical trials in which patients with initial tumor stages take part. In some
studies on new prognostic factors, multivariate analysis only looks at tumor size as either ⬎ 3 cm or ⬍ 3
cm,33 or as T1-T2.34 New assessments that take the
new prognostic spectrum of tumor size into account
may or may not confirm the independent value of
these new factors.
As previously discussed, prognostic accuracy improves when a more discriminative staging is performed using TNM descriptors instead of stages.5 This
improvement in prognostic discrimination also occurs,
as shown in our study, when a classificatory component
(such as tumor size) is examined in greater detail.
In conclusion, this multi-institutional study, conducted by the GCCB-S on NSCLC cases with
complete resection, did not find the 3-cm value to be
a prognostic threshold. The study did, however,
identify four prognostic groups with different tumor
sizes within initial pIA-IB stages.
Appendix: the GCCB-S
Coordinators: José Luis Duque, MD (Hospital Universitario,
Valladolid); Angel López-Encuentra, MD (Hospital Universitario
12 de Octubre, Madrid); Ramón Rami-Porta, MD (Hospital
Mutua de Terrassa, Barcelona).
Local representatives: Julio Astudillo, MD (Hospital Germans
Trias i Pujol, Barcelona); Emilio Canalı́s, MD; José Belda, MD
(Hospital Clinic, Barcelona); Antonio Cantó, MD; Antonio Arnau, MD (Hospital Clı́nico, Valencia); Juan Casanova, MD;
Manuel Mariñan, MD (Hospital de Cruces, Bilbao); Jorge
Cerezal, MD; José Marı́a Matilla, MD (Hospital Universitario,
Valladolid); Antonio Fernández de Rota, MD; Ricardo Arrabal,
MD (Hospital Carlos Haya, Málaga); Federico González Aragoneses, MD; Nicolás Moreno, MD (Hospital Gregorio Marañón, Madrid); Jorge Freixinet, MD; Pedro Rodrı́guez, MD
(Hospital Nuestra Señora del Pino, Las Palmas); Nicolás Llobregat, MD, (Hospital Universitario del Aire, Madrid); Nuria Mañes,
MD (Fundación Jiménez Dı́az, Madrid); Miguel Mateu, MD;
Guadalupe González Pont, MD (Hospital Mutua de Terrassa,
Barcelona); José Luis Martı́n de Nicolás, MD (Hospital Universitario 12 de Octubre, Madrid); Nuria Novoa, MD (Complejo
Hospitalario, Salamanca); Jesús Rodrı́guez, MD (Complejo Hospitalario, Oviedo); Antonio José Torres Garcı́a, MD (Hospital
Universitario San Carlos, Madrid); Mercedes de la Torre, MD
(Hospital Juan Canalejo, La Coruña); Abel Sánchez-Palencia,
MD; Ruı́z Zafra, MD (Hospital Virgen de las Nieves, Granada);
Andrés Varela de Ugarte, MD; Pablo Gamez, MD (Clı́nica
Puerta de Hierro, Madrid); Yat Wah Pun, MD (Hospital de la
Princesa, Madrid).
Data analysis: Agustı́n Gómez de la Cámara, MD; Francisco
Pozo Rodrı́guez, MD; Paloma Ferrando, MSc (Hospital Universitario 12 de Octubre, Madrid).
References
1 Mountain CF, Carr DT, Anderson WA. A system for the
clinical staging of lung cancer. AJR Am J Roentgenol Radium
Ther Nucl Med 1974; 120:130 –138
www.chestjournal.org
2 Sobin LH, Wittekind Ch. TNM classification of malignant
tumors. UICC International Union Against Cancer. 5th ed.
New York, NY: Wiley-Liss, 1997
3 Gospodarowicz MK, Henson DE, Hutter RVP, et al. Prognostic factors in cancer, 2nd ed. New York, NY: Wiley-Liss,
2001
4 López-Encuentra A, Bülzebruck H, Feinstein AR, et al.
Tumor staging and classification in lung cancer. Lung Cancer
2000; 29:79 – 83
5 Buccheri G, Ferrigno D. Prognostic value of stage grouping
and TNM descriptors in lung cancer. Chest 2000; 117:1247–
1255
6 Bronchogenic Carcinoma Cooperative Group of the Spanish
Society of Pneumology and Thoracic Surgery (GCCB-S).
Clinical tumor size and prognosis in lung cancer. Eur Respir
J 1999; 14:812– 816
7 Riquet M, Manach D, Le Pimpec-Barthes F, et al. Prognostic
value of T and N in non-small cell lung cancer three
centimeters or less in diameter. Eur J Cardiothorac Surg
1997; 11:440 – 443
8 Watanabe Y, Murakami S, Oda M, et al. Tumor size and
extension of lymph node metastases in N2 lung cancer. Ann
Ital Chir 1999; 70:889 – 892
9 Graham AN, Chan KJ, Pastorino U, et al. Systematic nodal
dissection in the intrathoracic staging of patients with nonsmall cell lung cancer. Thorac Cardiovasc Surg 1999; 117:
246 –251
10 Saito M, Nakamura H, Hiyoshi T, et al. Lymph node status of
small lung cancers 2.0 cm or less in size [abstract]. Lung
Cancer 2000; 29(suppl 2):141
11 Grupo Cooperativo de Carcinoma Broncogénico de SEPAR
(GCCB-S): cirugı́a del carcinoma broncogénico en España;
estudio descriptivo. Arch Bronconeumol 1995; 31:303–309
12 López Encuentra A. Criteria of functional and oncological
operability in surgery for lung cancer: a multicenter study.
The Bronchogenic Carcinoma Cooperative Group of the
Spanish Society of Pneumology and Thoracic Surgery
(GCCB-S). Lung Cancer 1998; 20:161–168
13 American Thoracic Society. Clinical staging of primary lung
cancer. Am Rev Respir Dis 1983; 127:659 – 664
14 Wittekind CH, Henson DE, Hutter RVP, et al. UICC TNM
supplement: a commentary on uniform use. 2nd ed. New
York, NY: Wiley-Liss, 2001
15 Izbicki JR, Passlick B, Karg O, et al. Impact of radical
systematic mediastinal lymphadenectomy on tumor staging in
lung cancer. Ann Thorac Surg 1995; 59:209 –214
16 Mountain CF. Revisions in the international system for
staging lung cancer. Chest 1997; 111:1710 –1717
17 Patz EF, Rossi S, Harpole DH, et al. Correlation of tumor
size and survival in patients with stage IA non-small cell lung
cancer. Chest 2000; 117:1568 –1571
18 Hessel P. Terminal digit preference in blood pressure measurements: effects on epidemiological associations. Int J
Epidemiol 1986; 15:122–125
19 Bennett S. Blood pressure measurement error: its effects on
cross-sectional and trend analyses. J Clin Epidemiol 1994;
47:293–301
20 Schoenfeld DA. Analysis of categorical data: logistic model.
In: Mike V, Stanley KE, eds. Statistics in medical research.
New York, NY: Wiley, 1982; 443– 454
21 Cox DR. Regression models and life table. J R Stat Soc 1972;
34:187–220
22 Hastings RP. Supplementary library user’s guide. Cary, NC:
SAS Institute, 1986; 437– 466
23 Nesbitt JC, Putnam JB, Walsh GL, et al. Survival in earlystage non-small cell lung cancer. Ann Thorac Surg 1995;
60:466 – 472
CHEST / 121 / 5 / MAY, 2002
1519
24 Patz EF, Goodman PC, Bepler G. Screening for lung cancer.
N Engl J Med 2000; 343:1627–1633
25 Padilla J, Calvo V, Peñalver JC, et al. Surgical results and
prognostic factors in early non-small cell lung cancer. Ann
Thorac Surg 1997; 63:324 –326
26 Black WC. Unexpected observations on tumor size and survival
in stage IA non-small cell lung cancer. Chest 2000; 117:1532–
1534
27 Reich J. Hazards of lung cancer screening. Chest 2001;
119:659 – 660
28 Watanabe Y, Shimizu J, Oda M, et al. Proposals regarding some
deficiencies in the new international staging system for nonsmall cell lung cancer. Jpn J Clin Oncol 1991; 21:160–168
29 Lacasse Y, Bucher HC, Wong E, et al. “Incomplete resection” in
non-small cell lung cancer: need for a new definition. Canadian
Lung Oncology Group. Ann Thorac Surg 1998; 65:220–226
1520
30 Bouchardy CH, Fioretta G, De Perrot M, et al. Determinants
of long term survival after surgery for cancer of the lung: a
population-based study. Cancer 1999; 86:2229 –2237
31 Jefferson MF, Pendleton N, Faragher EB, et al. “Tumor
volume” as a predictor of survival after resection of non-smallcell lung cancer. Br J Cancer 1996; 74:456 – 459
32 Deslauriers J, Grégoire J. Surgical therapy of early non-small
cell lung cancer. Chest 2000; 117:104S–109S
33 Ahuja V, Coleman RE, Hendon J, et al. The prognostic
significance of fluorodeoxyglucose positron emission tomography imaging for patients with non-small cell lung carcinoma. Cancer 1998; 83:918 –924
34 Marchetti A, Bertacca G, Buttitta F, et al. Telomerase activity
as a prognostic indicator in stage I non-small cell lung cancer.
Clin Cancer Res 1999; 5:2077–2081
Clinical Investigations
Copyright # ERS Journals Ltd 1999
European Respiratory Journal
ISSN 0903-1936
Eur Respir J 1999; 14: 812–816
Printed in UK – all rights reserved
Clinical tumour size and prognosis in lung cancer
Bronchogenic Carcinoma Cooperative Group of the Spanish Society of
Pneumology and Thoracic Surgery (GCCB-S)
Clinical tumour size and prognosis in lung cancer. Bronchogenic Carcinoma Cooperative
Group of the Spanish Society of Pneumology and Thoracic Surgery (GCCB-S). #ERS
Journals Ltd 1999.
ABSTRACT: In the staging of lung cancer (LC), tumour size is a variable that can be
used to separate primary tumour, regional nodes, metastasis (TNM), stages T1 and T2
(<3 or >3 cm). The objective of this study was to evaluate the prognostic value of
tumour size before thoracotomy and to determine whether tumour size can be used to
classify LC as T3.
This multi-institutional cooperative longitudinal prospective study in Spanish
hospitals located throughout the country, with a broad range of activity levels,
included all consecutive cases of LC treated surgically from October 1993 to
September 1996 (n=2,361).
Four prognostic groups, characterized by tumour size, were identified according to
the Schoenfeld procedure: a) 0–2 cm (n=173); b) 2.1–4 cm (n=542); c) 4.1–7 cm (n=
413); and d) >7 cm (n=77). The 2-yr survival rates by group were a=0.78 (95% confidence interval (CI) 0.71–0.84); b=0.67 (95% CI 0.62–0.71); c=0.58 (95% CI 0.53–0.63);
d=0.41 (95% CI 0.29–0.52). The log-rank comparisons of the survival curves were
significant for the four groups (a versus b=0.0008, b versus c=0.003, c versus d=0.016).
The clinical tumour size of lung cancer defined four prognostic groups (0–2 cm, 2.1–
4 cm, 4.1–7 cm; and >7 cm). Lung cancer with a diameter >7 cm had a prognosis
similar to that of stage T3 or stage IIB.
Eur Respir J 1999; 14: 812–816.
In Spain, the incidence and mortality of lung cancer
(LC) have increased in recent decades [1].
In the initial stages (stages I–II) of non-small-cell lung
cancer (NSCLC), the therapy of choice is surgery if the
patient can tolerate lung resection. However even in these
stages, surgery is not a guaranteed cure. Only 63.5% of
patients with stage I LC treated surgically survive $5 yrs
[2]. Moreover, the results obtained for the same prognostic groups vary widely from one series to another; for
instance, reported 5-yr survival rates for primary tumour,
regional nodes, metastasis (TNM) classification, T1N0M0
tumours range 68.5–83% [3].
These findings suggest the need for other factors, perhaps of a molecular type, to improve the accuracy of
prognostic predictions and to establish the most suitable
adjuvant therapies [4]. However, in spite of the initially
promising results that have been obtained in initial LC
with factors other than the TNM classification, subsequent studies have failed to confirm the reproducibility of
these factors as prognostic markers [5]. In recent studies
of resected NSCLC, certain molecular markers and tumour
size have shown a similar prognostic value in multivariate
analysis [6, 7]. In other studies of stage IIIA tumours with
complete resection, univariate analysis shows that tumour
size is not an independent prognostic factor for survival
when using a cut-off value of 4 cm, but variables such as
angiogenesis are [8]. In patients with NSCLC undergoing
surgery with intent to cure (stages I–IIIA), univariate
Correspondence: A. López-Encuentra
Pneumology Service
Hospital Universitario 12 de Octubre
Ctra. de Andalucá, km 5,4
E-28041 Madrid
Spain
Fax: 34 913908358
Keywords: Cohort study
lung neoplasm
registry
staging
TNM classification
tumour size
Received: January 19 1999
Accepted after revision May 15 1999
This work was partly financed by FIS
grant (97/0011), FEPAR-PENSA 1995
grant, and financial aid from the CastillaLeón government and Menarini Foundation.
analysis confirms the prognostic value of molecular factors, separately or associated, but not the prognostic value
of the surgical-pathologicaltumour size classification [9].
One source of discrepancies in the prognostic value of
molecular factors may be the inconsistency of measurements of the fundamental prognostic factors [3], which
are included in the classification of anatomic extension
(TNM classification stages) [10, 11].
Assuming that studies of multiple prognostic factors in
LC are a necessary step toward improving our capability
for predicting prognosis, each factor used to classify anatomic extension should be analysed independently. The
most frequent category is T2, defined as a tumour >3 cm in
diameter (with no upper limit), with or without other
circumstances (proximity to a main bronchus, visceral
pleural invasion, atelectasis or pneumonitis involving less
than a whole lung). The validation or correction, if necessary, of the data that sustain anatomic classifications is
the first goal in the construction of multifactorial prognostic indexes [12]. As noted by a consensus group of the
International Association for the Study of Lung Cancer
(IASLC), the construction of prognostic scales in LC
using data collected before 1980 may yield questionable
results [12]. Therefore, the IASLC has appointed a
staging group to consider, among other questions, "confirmation of the prognostic independence of size in T2 (3
cm versus 4 cm versus 5 cm, etc) in cases of resectable
NSCLC" [12].
813
TUMOUR SIZE AND PROGNOSIS IN LUNG CANCER
The goal of this study was to evaluate the prognostic
value of clinical tumour size. It was determined whether
various cut-off values for tumour diameter, in the absence
of either visceral pleural involvement or other anatomic
factors justifying a higher T classification, or metastases to
lymph nodes or at a distance, could be an independent
prognostic factor for classifying tumours as higher tumour
(T) (T3) or stage classification in the clinical phase before
thoracotomy.
Table 2. – Initial total number of patients and exclusions
for each study year
Material and methods
conditions were met by 1,205 cases, which included incomplete resections and exploratory thoracotomies because these particular conditions were not known at the
time of the "clinical phase" analysis before thoracotomy.
Study subjects
All the patients included in the study had lung cancer
in initial stages and underwent thoracotomy with intent
to cure in hospitals pertaining to the Bronchogenic Carcinoma Cooperative Group of the Spanish Society of
Pneumology and Thoracic Surgery (GCCB-S) [13]. The
population characteristics are described in table 1. In
summary, the authors prospectively included all patients
treated surgically from October 1993 to September 1996
in hospitals participating in the GCCB-S who presented
the clinical picture that defined the initial population
(table 1) [13]. The annual cumulative number of cases
was close to 50% of total cases occurring in Spain. The
participating GCCB-S centres had a wide variety of activities, including a representative range of number of
beds, teaching or research activities (university and nonuniversity hospitals), public and private ownership, and
number of interventions per year (8–100 interventions
were performed in participating centres for this disease).
The sample was complete, as verified by the inclusion in
the registry of all patients undergoing surgery, including
incomplete resections and exploratory thoracotomy.
Table 2 shows the initial total number of patients and
exclusions for each study year. Death due to operative
mortality has been excluded. The final number of cases
included in the study of prognostic factors was 1,859.
For the study of clinical tumour size as a prognostic
factor, the cases classified as T1 or T2 without involvement
of the visceral pleura, regional lymph nodes (with classificatory certainty) (see Methods section), or metastases at a
distance were considered. Within the T2 criteria, proximity
to the main bronchus was not considered to be an exclusion
factor in this study because of its low probability of modifying the prognosis [14]. Although a correct multivariate
analysis of all the cases should control the prognostic
value of tumour size using other T or nodal (N) factors, it
was considered more appropriate to avoid contaminating
the results with data from more advanced tumours. These
Table 1. – Population characteristics
Clinical situation index
Bronchogenic carcinoma
Initial stages
Thoracotomy
Sample attributes
Representativity
Completeness
Exclusion criteria
Operative mortality
Neoadjuvant treatment with surgery
Unknown evolution since surgery
Patients registered
Surgical mortality
Induction treatment
Loss of follow-up
Final population
1993–94
1994–95
1995–96
Total
718
51
42
13
610
822
62
31
94
634
821
75
38
96
611
2361
188
111
203
1859
Methods
In accordance with the initial design, the period of case
recruitment was short. The same criteria for the functional
operability of patients and oncological operability of the
tumour were used in all the GCCB-S hospitals [15].
Each variable recorded in the registry was accompanied
by the diagnostic procedure used for its classification.
When several procedures were used, the procedure with
the best resolution was chosen. Depending on the characteristics of the tumour, clinical tumour size was established
using a chest radiograph or computerized axial tomography (CAT); for instance, in vertical diameters, a radiograph
may, in some patients, prove to be more reliable than CAT.
For other characteristics, for example, the classification of
clinical N2 involvement, CAT or mediastinoscopy was
used and the procedure was recorded in the registry. The
degree of certainty of the TNM-stages classification depends on the diagnostic methods used. According to some
international organizations, postmortem study yields the
maximum certainty factor and the clinical findings yield
the minimum certainty factor [10].
The clinical classification of isolated involvement of the
visceral pleura is considered certain only if it is verified by
a validated procedure (thoracoscopy). The classification of
clinical N0 requires, as a minimum, the absence of lymph
node involvement of >1 cm in diameter in areas 4, 7, and
10 in CAT or magnetic resonance imaging (MRI), or the
presence of negative mediastinoscopy in these zones [16].
For the clinical N1 classification, cytohistological certainty is based on transbronchial fine needle aspiration
biopsy (FNAB) or hilioscopy, and none of the patients in
these series underwent these tests. To confirm the presence of clinical N2, cytohistological certainty obtained
by transbronchial,transthoracic or transesophagealFNAB,
by mediastinoscopy-mediastinotomy,or by thoracoscopy
is required.
Surgical-pathological N0 is classified by radical mediastinal lymph node dissection or sampling of at least four
lymph node areas (2 (only in right LC), 4, 7, and 10 on the
same side as the tumour) [16]. For the purpose of classifying the presence or absence of mediastinal lymph
node involvement, a randomized study has demonstrated
that sampling has a value similar to that of radical
mediastinal lymph node dissection [17].
Internal and external audits were made firstly to review
the ratio between the number of patients undergoing surgery and the number of cases included in the registry
(standard over 95%) and secondly, to review the validity
814
GCCB-S
Analysis
The Schoenfeld procedure [19] was used to identify
intervals of tumour size related with specific survival
outcomes. In this procedure, the continuous variable of
tumour size was reclassified arbitrarily into intervals or
unit segments (centimetres in this case) with suspected
clinical significance. A series of consecutive and overlapping segments was generated and its correlation with
survival was confirmed statistically using the Cox proportional risk procedure [20], which revealed the magnitude of the relative risk for each stratum.
The 2-yr and 3 yr survival of the resulting prognostic
groups was anaysed and 95% confidence intervals (CI)
were calculated using life tables (actuarial survival) and
log-rank comparisons of survival curves. Statistical significance was adjusted using the Bonferroni correction for
paired comparisons between strata [21].
Results
Population characteristics
The mean age of the studied population for the purpose
of examining clinical tumour size in relation to prognosis
was 63.4±11 yrs (SD). The clinical tumour type was
epidermoid in 526 patients (44%), adenocarcinoma in 306
(25%), large cell carcinoma in 185 (15%), unclassified
carcinoma (non-small cell) in 180 (15%), and small-cell in
8 patients (1%). Tumour size in small-cell lung cancer
ranged 1.5–4 cm. Ninety per cent of the patients were
male. Exploratory thoracotomy was performed in 161
patients (13%), lobectomy or bilobectomy in 744 patients
(62%), pneumoectomy in 270 (22%), and segmentectomy,
atypical resection, or a combination of procedures in the
rest of the patients
1
Survival
of the data recorded for each case (standard >70%), including the consistency of tumoural staging. The criterion
for the validity of the survival data was established as the
existence of a known follow-up for $85% of the cases
registered in each hospital [18]. In the hospitals that did
not meet all these conditions, the cases corresponding to
the period of problems were excluded. Finally, correct
data transmission by a single central office from the paper
record to the computer database was verified.
These procedures were designed to control the following aspects: selection bias of surgical cases; registered
cases out of the total number of surgical cases; sample size;
type of hospital; prognostic migration due to the prolonged
period of case recruitment; classification with low or
deficient degrees of certainty; contamination by data from
incomplete series or erroneous data, and loss of long-term
follow-up.
0.5
0
0
12
24
Months after treatment
36
Fig. 1. – Cumulative probability of survival after treatment according to
clinical tumour size; : 0–2 cm in diameter; – – – : 2.1–4 cm; - - - : 4.1–7
cm; – - – - : >7 cm. Operative deaths are excluded.
Clinical tumour size
Mean tumour size before thoracotomy in the 1,205 classified cases was 4.24 cm (SD 1.97; median 2.4 cm; range
0.5–15 cm). In these 1,205 cases categorized as T1–T2
without visceral pleural involvement, N0 metastasis (M0),
12-month survival was 0.78 (95% CI 0.76–0.80) and 24month survival was 0.63 (95% CI 0.60–0.66).
Using the Schoenfeld procedure [19], the Cox method
[20] several cut-off values of tumour size were determined and selected on the basis of survival. Four tumour
size intervals, generally 2–7 cm (table 3) were found.
Each interval increased the risk of death by 50.8%, with
respect to the previous stratum; the different intervals
showed increases of the same magnitude in the 2-yr and
3-yr survival analysis. In this study, 3 cm was not a cutoff value for tumour size between prognostic categories.
The tumour-size groups had short-term survivals (1–2
yrs after surgery), showing statistically significant differences (table 3). At 3 yrs the statistical differences between
the four groups were maintained (log-rank =0.0002,
0.009, 0.002, respectively) (fig. 1).
Discussion
The goal of the study was to analyse the prognostic
value of clinical tumour size (as determined by radiology)
of LC, independently of other factors, in initial clinical
(c)T1–T2 stages without invasion of local structures
(visceral pleura), involvement of regional lymph nodes,
or distant metastases. Apart from being helpful in other
areas, such information is perceived to be a valuable tool
in quantifying the magnitude of benefit of the surgical
Table 3. – Prognostic groups and survival defined by clinical tumour size in relation to risk of death*
Group
a
b
c
d
Size
diameter in cm
n
Risk ratio 2 yrs
95% CI
0–2
2.1–4
4.1–7
>7
173
542
413
77
1
1.9 (1.3–2.7)
2.6 (1.8–3.7)
3.9 (2.5–6.2)
S1
95% CI
0.90
0.82
0.72
0.62
(0.86–0.95)
(0.79–0.86)
(0.68–0.76)
(0.51–0.73)
S2
95% CI
0.78
0.67
0.58
0.41
(0.71–0.84)
(0.62–0.71)
(0.53–0.63)
(0.29–0.52)
Log-rank
0.0008
0.003
0.016
Data are presented as absolute number with 95% confidence intervals in parentheses. *: according to the procedure of SCHOENFELD [19].
The risk ratio was calculatedaccording to the Cox method [20]; S1: cumulative probabilityof survival at 1 yr; S2: cumulative probabilityof survival
at 2 yrs.
TUMOUR SIZE AND PROGNOSIS IN LUNG CANCER
treatment with regard to risk. The study comprised a large
series of recent cases collected over a short time period.
The study was multi-institutional and representative of
cases of LC treated surgically in Spain, with an initial
design conceived to control the usual bias in prognostic
and/or therapeutic studies. These aspects of the methodology are particularly important in view of the variations in
survival reported by different series for the same prognostic categories of LC [3].
The analysis found four groups of clinical tumour sizes
related to risk of death: 0–2 cm; 2.1–4 cm; 4.1–7 cm; and
>7 cm. The 3 cm value was not confirmed as a prognostic
separator in staging by the current study. The short-term
survival (1–2 yrs) after surgery in the group of patients
with tumours >7 cm in diameter is similar to that of TNM
anatomic classifications and/or stages superior to T2/IB
(table 4). For LC >7 cm in diameter, the 2-yr probability
of survival is closer to that of cT3N0M0 or cT2N1M0, or
stage cIIB [22], than to the survival of the category in
which it theoretically belongs, cT2N0M0 (2-yr survival
probability: 0.54) [22].
When evaluating these results, the univariate nature of
the study, which excluded other LC groups from analysis,
should be emphasized. These other LC groups, might, in
multivariate analysis, demonstrate the independent prognostic value of tumour size, even in the presence of more
advanced tumour classification conditions.
The comparison of the present data with a recently
published study of survival using the TNM-staging classification [22] is appropriate because its prognostic data
was used for the elaboration of the new 1997 classification [11], (data is reported in clinical and/or surgicalpathological categories on a yearly basis for 5 yrs), and
also because it includes small-cell LC in cT1-2N0M0
(3.8% in their series [22]) and excludes cases of surgical
mortality that occurred in the first 30 days after surgery.
However, it is not clear if thoracotomy with incomplete
resection and exploratory thoracotomy are included in the
data relative to the clinical phase and the surgicalpathological classification.
Each prognostic category of the TNM classification (T1,
T2, N2, etc) contains distinct internal components (tumour
size, atelectasis, invasion of specific neighbouring structures). In theory, each component should be analysed independently so that, after a correct classification has been
made, their prognostic value in relation to different survival times can be determined.
Of the components making up each prognostic category,
the first factor evaluated by the GCCB-S was tumour size.
This variable has a high level of classificatory certainty that
is attainable with simple, universally available methods
(chest radiograph or thoracic CAT); no prognostic migration is expected as a result of advances in diagnostic
Table 4. – Prognostic equivalence between some clinical
tumour sizes and the new tumour classification (1997)
First author [Ref]
Present author
MOUNTAIN [22]
MOUNTAIN [22]
MOUNTAIN [22]
Category
n
2-yr
survival
T >7 cm, N0, M0
T3, N0, M0
T2, N1, M0
IIB
77
107
250
357
0.41
0.37
0.42
0.41
815
technology. The prognostic value of tumour size has been
studied for many years [23–25]. In 1974, the first TNM
classification was described after an evaluation of more
than 300 curves and survival tables for 2,155 patients
treated in the previous 4 yrs [26], which has conserved its
basic structure until the present. One criterion that has not
changed is the tumour size used to differentiate the T1
and T2 categories, which has a cut-off value of 3 cm. In
fact, T3, as described in 1974, has undergone more
modifications as a result of the prognostic stratification of
its internal variables. However, T2 has not changed substantially other than to incorporate visceral pleural involvement. In a recent publication of prognostic data,
which largely sustains the new tumoural classification of
anatomic extension of 1997 [22], ~7,000 cases were
evaluated, of which >5,000 cases were collected after
1975 and almost 4000 cases were evaluated before CAT
was introduced in 1982.
As shown in table 4, the prognostic significance of
tumours >7 cm is similar to that of TNM groups or more
advanced clinical stages. Compared with other recent
experiences (2,382 resected NSCLC), the probability of
survival at 2 yrs calculated by the GCCB-S for tumours
>7 cm in diameter was similar to that of stage IIIA (T.
Naruke, National Cancer Centre, Tokyo, Japan; personal
communication, 1997). Some groups have recommended,
in the light of survival data, that LC >5 cm in diameter be
classified as a higher category of T2 (stage IB) or by
creating a new category, T2bN0M0, within stage II [24].
In recent literature, cases of LC treated by surgical
resection in Spain show significant prognostic differences
for small variations in tumour size: for example, between
two groups of tumours <3 cm (0–2 cm versus 2–3 cm)
found in a population of 154 T1N0M0 patients had significantly different 5- and 10-yr prognoses after surgery [14].
In initial stages of LC in functionally inoperable patients
who were treated by irradiation, different survival levels
(considering only LC-specific mortality) have been detected for different tumour-size cut-off values. The 3-yr
survival rate was 30% for tumours >3 cm, 17% for 3–6 cm,
and 0% for tumours >6 cm (only 9 cases) [27].
Prognostic results vary for initial lung cancer stages
when the variable tumour size is controlled, even when
restricted to T1-2N0M0 groups. This may be due to the
presence of other variables contained within T1 or T2 [10],
to biological-molecular factors [4], or to association with
other diseases [28]. With regard to comorbidity, a large
percentage of patients with initial stages of LC die from
associated disease [27, 28].
This study has certain limitations, the first of which is
the absence of internal validation. The study population is
described herein, but not the validation population, which
has not yet been evaluated because it was recruited in the
final year (1996–1997). Another limitation is that the data
correspond to a short follow-up period (2 yrs), although
ideally the final analysis time in LC should be 10 yrs.
However, values obtained at 1, 2 and 3 yrs and the survival
curves are fundamental for responsible decision-making by
the physician and patient [29].
Given the current possibilities for obtaining homogeneous populations and using homogeneous study methods,
and the current ease of information exchange, a process of
convergence among databases throughoutthe world should
be started and their compatibility studied. This would lead
816
GCCB-S
to larger and more representative sample sizes; which
would probably improve prediction and prognostic accuracy. This measure is considered necessary and is defended
as a major research challenge in lung cancer by the International Association for the Study of Lung Cancer [12],
which proposes to "collect and review existing databases
of cooperative groups and other institutions in order to
validate clinical primary tumour, regional nodes, metastasis" in non-small-cell lung cancer.
Bronchogenic carcinoma cooperative group of the Spanish society of pneumology and thoracic surgery
Coordinators: J. Luis Duque (Hospital Universitario, Valladolid); A. López Encuentra (Hospital Universitario 12 de Octubre,
Madrid); R. Rami Porta (Hospital Mutua de Terrassa, Barcelona).
Local representatives: J. Astudillo (Hospital Germans Trias i
Pujol, Barcelona); E. Canalś, J. Belda (Hospital Clinic, Barcelona); A. Cantó, A. Arnau (Hospital Clńico, Valencia); J. Casanova, M. Mariñan (Hospital de Cruces, Bilbao); J. Cerezal, F.
Heras (Hospital Universitario, Valladolid); A. Fernández de Rota,
R. Arrabal (Hospital Carlos Haya, Málaga); F. González Aragoneses, N. Moreno (Hospital Gregorio Marañón, Madrid); J.
Freixinet, P. Rodrǵuez Suarez (Hospital Nuestra Señora del Pino,
Las Palmas); N. Llobregat, J. Antonio Garrido (Hospital Universitario del Aire, Madrid); N. Mañes, J.M. Garcá Prim (Fundación Jiménez Dáz, Madrid); M. Mateu, E. Barbeta Sanchez
(Hospital Mutua de Terrassa, Barcelona); J. Luis Martń de
Nicolás, C. Marrón (Hospital Universitario 12 de Octubre, Madrid); N. Novoa (Complejo Hospitalario, Salamanca); J. Rodrǵuez, F.A. de Linera (Complejo Hospitalario, Oviedo); A. José
Torres Garcá, A. Gómez (Hospital Universitario San Carlos,
Madrid); J. José Rivas, M. de la Torre (Hospital Juan Canalejo, La
Coruña); A. Sanchez-Palencia, F. Javier Ruiz Zafra (Hospital
Virgen de las Nieves, Granada); A. Varela Ugarte, P. Gamez
(Clńica Puerta de Hierro, Madrid); Y. Wah Pun (Hospital de la
Princesa, Madrid). Data analysis: P. Ferrando, A. Goméz de la
Cámara (Unidad de Epidemiologá Clńica, Hospital Universitario
12 de Octubre, Madrid).
References
1.
2.
3.
4.
5.
6.
7.
8.
Izarzugaza Lizarraga I. El cáncer de pulmón en España.
Revisión epidemiológica. Arch Bronconeumol 1992; 28:
311–319.
Mountain CF. A new internationalstaging system for lung
cancer. Chest 1986; 89: Suppl. 4, 225–233.
Nesbitt JC, Putnam JB, Walsh GL, Roth JA, Mountain
CF. Survival in early-stage non-small cell lung cancer.
Ann Thorac Surg 1995; 60: 466–472.
Hermanek P, Gospodarowicz MK, Henson DE, Hutter
RVP, Sobin LH. Prognostic factors in cancer, 1st Edn.
Berlin, Springer-Verlag, 1995.
Pastorino U, Andreola S, Tagliabue E, et al. Immunocytochemical markers in stage I lung cancer: relevance to
prognosis. J Clin Oncol 1997; 15: 2858–2865.
Fontanini G, Lucchi M, Vignati S, et al. Angiogenesis as
a prognostic indicator of survival in non-small-cell lung
carcinoma: a prospective study. J Natl Cancer Inst 1997;
89: 881–886.
Apolinario RM, Van-der-Valk P, de Jong JS, et al. Prognostic value of the expression of p53, bc1–2, and bax
oncoproteins, and neovascularization in patients with radically resected non-small-cell lung cancer. J Clin Oncol
1997; 15: 2456–2466.
Angeletti CA, Lucchi M, Fontanini G, et al. Prognostic
significance of tumoral angiogenesis in completely resec-
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
ted late stage lung carcinoma (stage IIIA-N2). Cancer
1996; 78: 409–415.
Dosake-Akita H, Hu SX, Fujimo M, et al. Altered
retinoblastoma protein expression in non-small cell lung
cancer. Cancer 1997; 79: 1329–1337.
Sobin LH, Wittekind Ch. UICC International Union
Against Cancer, TNM Classification of malignant tumors.
Fifth edition. New York, Wiley-Liss, 1997.
American Thoracic Society/European Respiratory Society. Pretreatment evaluation of non-small-cell lung cancer. Am J Respir Crit Care Med 1997; 156: 320–332.
Ginsberg R, Cox J, Green M, et al. Staging Classification
Committee Consensus report. Lung Cancer 1997; 17:
Suppl. 1, 11–13.
Grupo Cooperativo de Carcinoma Broncogénico de
SEPAR (GCCB-S). Cirugá del carcinoma broncogénico
en España. Estudio descriptivo.Arch Bronconeumol1995;
31: 303–309.
Padilla J, Calvo V, Peñalver JC, Sales G, Morcillo A.
Surgical results and prognostic factors in early non-small
cell lung cancer. Ann Thorac Surg 1997; 63: 324–326.
López Encuentra A and the Bronchogenic Carcinoma
Cooperative Group of the Spanish Society of Pneumology and Thoracic Society (GCCB-S). Criteria of functional and oncologicaloperability in surgery for lung cancer.
A multicenter study. Lung Cancer 1998; 20: 161–168.
American Thoracic Society. Clinical staging primary lung
cancer. Am Rev Respir Dis 1983; 127: 1–6.
Izbicki JR, Passlick B, Karg O, et al. Impact of radical
systematic mediastinal lymphadenectomy on tumor staging in lung cancer. Ann Thorac Surg 1995; 59: 209–214.
Grupo Cooperativo de Carcinoma Broncogénico de
SEPAR (GCCB-S). Control de calidad en un registro
multiinstitucional de carcinoma broncogénico. Arch
Bronconeumol 1996; 32: Suppl. 2, 70.
Schoenfeld DA. Analysis of categorical data: logistic
model. In: Mike and Stanley KE, eds. Statistics in Medical Research. New York, Wiley, 1982; pp. 433–454.
Cox DR. Regression models and life table. J R Stat Soc
1972; 34: 187–220.
Hastings RP. Supplementary library user’s guide. Cary,
NC, USA, SAS Institute, 1986; 437–466.
Mountain CF. Revisions in the International System for
staging lung cancer. Chest 1997; 111: 1710–1717.
Soorae AS, Abbey-Smith R. Tumor size as a prognostic
factor after resection of lung carcinoma. Thorax 1977; 32:
19–25.
Watanabe Y, Shimizu J, Oda M, et al. Proposals regarding
some deficiencies in the new international staging system
for non-small cell lung cancer. Jpn J Clin Oncol 1991; 21:
160–168.
Strauss GM. Prognostic markers in resectable non-small
cell lung cancer. Hemat Oncol Clin North Am 1997; 11:
409–434.
Mountain CF, Carr DT, Anderson WAD. A system for the
clinical staging of lung cancer. Am J Roentg Rad Ther
Nucl Med 1974; 120: 130–138.
Sandler HM, Curran WJ, Turrisi III AT. The influence of
tumor size and pre-treatment staging on outcome following radiation therapy alone for stage I non-small cell lung
cancer. Int J Radiat Oncol Biol Phys 1990; 19: 9–13.
Pastorino U, Valente M, Bedini U, et al. Effect of chronic
cardiopulmonary disease on survival after resection for
stage Ia lung cancer. Thorax 1982; 37: 680–683.
Mazur DJ, Hickam DH. Five-year survival curves: How
much data are enough for patient-physiciandecision making in general surgery? Eur J Surg 1996; 162: 101–104.
APLICACIÓN DE LAS MATRICES
DE TEJIDO (“TISSUE MICROARRAYS”)
AL ESTUDIO DE LOS CARCINOMAS
DE PULMÓN NO MICROCÍTICOS
Fernando López-Ríos
Hospital Universitario 12 de Octubre
Madrid
Contenido:
Resumen de la ponencia
Bibliografía
Aplicación de las matrices de tejido
(“tissue microarrays”) al estudio de los carcinomas
de pulmón no microcíticos
Fernando López-Ríos
Departamento de Anatomía Patológica
Hospital Universitario 12 de Octubre, Madrid
Introducción
A pesar del extendido concepto de que los carcinomas pulmonares son relativamente homogéneos
desde el punto de vista histológico, la realidad es bien distinta. En la recientemente publicada clasificación
de tumores pulmonares de la Organización Mundial de la Salud se llega a considerar que hasta el 50%
de estos tumores presentan varios tipos histológicos, lo que evidentemente dificulta su diagnóstico
anatomopatológico y, por extensión, su estudio clínico y biológico. Por tanto, la división histológica se
basa en muchas ocasiones en porcentajes, presencia de un determinado rasgo microscópico, etc., hechos
que no reflejan de forma precisa las características clínico-biológicas del tumor. Como ejemplos de esta
relativa imprecisión me gustaría referirme a los siguientes:
– Falta de consenso en los criterios del adenocarcinoma bronquioloalveolar.
– Llamativa heterogeneidad histológica en los carcinomas epidermoides, no siendo infrecuentes
los carcinomas epidermoides típicos que presentan áreas de enorme atipia y pleomorfismo.
– Utilización excesiva del diagnóstico genérico de “carcinoma de pulmón de células grandes”, al
ser éste un diagnóstico de exclusión.
Por todo lo anteriormente descrito no sorprende demasiado que el carcinoma de pulmón sea,
comparándolo con otras neoplasias y considerando su elevada frecuencia y mortalidad (más de 1 millón
de muertes anuales, supervivencia a los 5 años de un 10%), relativamente desconocido desde el punto
de vista anatomopatológico y biológico.
Las matrices de tejido (“tissue microarrays”)(1-7)
La idea de estudiar muchos tejidos simultáneamente en una sola sección no es nueva y data de
los años 80. Sin embargo, la técnica de las matrices de tejido (“tissue microarrays”), descrita con detalle
en 1998, permite estudiar y localizar de manera rápida y precisa muchos cilindros de tejido en una sola
sección histológica. El primer paso en la construcción de una matriz de tejido es seleccionar las áreas
de interés en los sucesivos bloques de parafina (“bloques donantes”). De las zonas marcadas se obtendrán
cilindros de tejido (mediante un aparato de precisión previsto de sondas metálicas), que se insertarán
ordenadamente en forma de matriz en un bloque vacío de parafina (“bloque receptor”). Como es
evidente el paso previo a la inserción consiste en la realización de un agujero en el bloque receptor,
que permitirá albergar el cilindro procedente del bloque donante. Las sondas utilizadas para estas
operaciones son de diámetros variables, aunque posiblemente las más usadas sean de 0,6 mm. Una vez
finalizada la matriz, el bloque de parafina puede ser utilizado con múltiples fines, principalmente estudios
inmunohistoquímicos, produciendo al menos 100 secciones. Es todavía objeto de cierto debate qué se
puede considerar representativo de una sección completa (número de cilindros del mismo caso y su
Aplicación de las matrices de tejido (“tissue microarrays”)
al estudio de los carcinomas de pulmón no microcíticos
131
diámetro). La heterogeneidad intratumoral no parece ser un obstáculo para el uso de matrices de
tejido; como regla general cada tumor debe ser incluído al menos en duplicado, y es fundamental una
selección muy cuidadosa de las áreas que van a ser muestreadas.
Probablemente la mayor utilidad actual de las matrices de tejido es su uso en la validación de
la información generada mediante el estudio de los perfiles de expresión génica, demostrando en la
mayoría de las ocasiones que los niveles elevados de mRNA se correlacionan con niveles elevados de
proteína, estudiada mediante inmunohistoquímica. El que esta validación, que idealmente debe de ser
realizada en una serie independiente de casos, pueda ser realizada mediante una técnica muy estandarizada
y difundida como es la inmunohistoquímica, está permitiendo explorar de forma más rápida y reproducible
las hipótesis generadas mediante el estudio de los perfiles de expresión génica.
Utilización de las matrices tisulares para el estudio del carcinoma
de pulmón no microcítico
Validación conjunta de marcadores publicados previamente de forma individual.
Esta es la aplicación más inmediata de las matrices de tejido. Por un lado, podemos en una sola sección
estudiar tumores de muy diferente histología; por otro, se pueden analizar de forma conjunta docenas
de proteínas. En este sentido, son interesantes los trabajos recientes de Au et al.(8) y de Ullmann et
al.(9) en donde analizan múltiples proteínas usando matrices de tejido, que contenían más de 100
carcinomas de pulmón no microcíticos.
Validación de la información obtenida mediante el uso de matrices de DNA.
Yang et al.(10) y Meyerson et al.(11) revisan recientemente los estudios de perfiles de expresión génica
en cáncer de pulmón. La información de algunos de ellos es pública y gratuita. Los genes identificados
pueden eventualmente ser validados mediante matrices de tejido, si ésto no ha sido ya realizado.
Cualquiera que sea el abordaje que utilicemos para seleccionar los genes de interés (y sus
correspondientes proteínas y anticuerpos de inmunohistoquímica), éstas serían algunas de las principales
aplicaciones(12-23):
– Correlación con los datos clínicos (principalmente con la supervivencia global) con el fin de
identificar marcadores con valor pronóstico.
– Diagnóstico diferencial entre subtipos histológicos o identificación de nuevas categorías dentro
de los mismos.
– Diagnóstico diferencial con otras neoplasias.
– Diagnóstico diferencial entre la neoplasia y su correspondiente parénquima no tumoral.
– Correlación con datos moleculares o citogenéticos.
132
Cáncer de pulmón
Bibliografía
1.
Kononen J, Bubendorf L, Kallioniemi A, Bärlund M, Schraml P, Leighton S, Torhorst J, Mihatsch MJ,
Sauter G, Kallioniemi OP. Tissue microarrays for high-throughput molecular profiling of tumor
specimens. Nat Med 1998, 4 (7): 844-847.
Descripción por vez primera de una matriz de tejido.
2.
http://www.beecherinstruments.com
La compañía más prestigiosa que produce matrices de tejido proporciona información útil de esta
técnica.
3.
http://www.tissuearray.org/
Ejemplo de un laboratorio de referencia de matrices de tejido, en este caso el de la Universidad de
Yale.
4.
Liu CL, Prapong W, Natkunam Y, Alizadeh A, Montgomery K, Gilks CB, van de Rijn M. Software
tools for high-throughput analysis and archiving of immunohistochemistry staining data obtained
with tissue microarrays. Am J Pathol 2002, 161: 1557-1565.
5.
Van de Rijn M, Gilks CB. Applications of microarrays to histopathology. Review. Histopathology
2004, 44: 97-108.
6.
Lakhani SR, Ashworth A. Microarray and histopathological analysis of tumours: the future and the
past? Nat Rev Cancer 2001, 1: 151-157.
7.
Packeisen J, Korsching E, Herbst H, Boecker W, Buerger H. Demystified…Tissue microarray
technology. J Clin Pathol: Mol Pathol 2003; 56: 198-204.
Tres artículos generales sobre la técnica de las matrices de tejido; el primero de ellos tiene una
orientación muy anatomopatológica y explica muy bien las matrices de cDNA y su relación con las
matrices de tejido.
8.
Au NHC, Cheang M, Huntsman DG, Yorida E, Coldman A, Elliott WM, Bebb G, Flint J, English J,
Gilks CB, Grimes HL. Evaluation of immunohistochemical markers in non-small cell lung cancer
by unsupervised hierarchical clustering analysis: a tissue microarray study of 284 cases and 18
markers. J Pathol 2004; 204: 101-109.
9.
Ullmann R, Morbini P, Halbwedl I, et al. Protein expression profiles in adenocarcinomas and
squamous cell carcinomas of the lung generated using tissue microarrays. J Pathol 2004; 203: 798807.
Dos grandes series de carcinomas de pulmón no microcíticos estudiados mediante matrices de tejido.
10.
Yang P, Sun Z, Aubry MC, Kosari F, Bamlet W, Endo C, Molina JR, Vasmatzis G. Study design
considerations in clinical outcome research of lung cancer using microarray analysis. Lung cancer
2004, 46: 215-226.
11.
Meyerson M, Franklin WA, Kelley MJ. Molecular classification and molecular genetics of human
lung cancers. Sem Oncol 2004; 31 : 4-19.
Resumenes útiles de los principales estudios de los perfiles de expresión génica en cáncer de pulmón.
12.
Sugita M, Geraci M, Gao B, et al. Combined use of oligonucleotide and tissue microarrays identifies
cancer/testis antigens as biomarkers in lung carcinoma. Cancer Res 2002, 62: 3971-3979.
13.
Wikman H, Kettunen E, Seppänen JK, et al. Identification of differentially expressed genes in
pulmonary adenocarcinoma by using cDNA array. Oncogene 2002; 21: 5804-5813.
Aplicación de las matrices de tejido (“tissue microarrays”)
al estudio de los carcinomas de pulmón no microcíticos
133
14.
Parmigiani G, Garrett-Mayer ES, Anbazhagan R, Gabrielson E. A cross-study comparison of gene
expression studies for the molecular classification of lung cancer. Clin Cancer Res 2004; 10: 29222927.
15.
Giordano TJ, Shedden KA, Schwartz DR, et al. Organ-specific molecular classification of primary
lung, colon and ovarian adenocarcinomas using gene expression profiles. Am J Pathol 2001;159:
1231-1238.
16.
Bhattacharjee A, Richards WG, Staunton J, et al. Classification of human lung carcinomas by mRNA
expression profiling reveals distinct adenocarcinoma subclasses. Proc Natl Acad Sci 2001; 98:
13790-13795.
17.
Beer DG, Kardia SLR, Huang CC, et al. Gene-expression profiles predict survival of patients with
lung adenocarcinoma. Nat Med 2002; 8: 816-824.
18.
Wigle DA, Jurisica I, Radulovich N, et al. Molecular profiling on non-small cell lung cancer and
correlation with disease-free survival. Cancer Res 2002; 62: 3005-3008.
19.
Garber ME, Troyanskaya OG, Schluens K, et al. Diversity of gene expression in adenocarcinoma
of the lung. Proc Natl Acad Sci 2001; 98: 13784-13789.
20.
Jones MH, Virtanen C, Honjoh D, et al. Two prognostically significant subtypes of high-grade lung
neuroendocrine tumours independent of small-cell and large-cell neuroendocrine carcinomas
identified by gene expression profiles. Lancet 2004; 363: 775-781.
21.
Kikuchi T, Daigo Y, Katagiri T, et al. Expression profiles of non-small cell lung cancers on cDNA
microarrays: Identification of genes for prediction of lymph-node metastasis and sensitivity to anticancer drugs. Oncogene 2003; 22: 2192-2205.
22.
Borczuk AC, Gorenstein L, Walter KL, et al. Non-small-cell lung cancer molecular signatures
recapitulate lung developmental pathways. Am J Pathol 2003; 163: 1949-1960.
23.
Wikman H, Seppänen JK, Sarhadi VK, et al. Caveolins as tumour markers in lung cancer detected
by combined use of cDNA and tissue microarrays. J Pathol 2004; 203: 584-593.
Principales estudios de los perfiles de expresión génica en carcinoma de pulmón.
134
Cáncer de pulmón
METILACIÓN
Y CÁNCER DE PULMÓN
Manel Esteller
Centro Nacional de Investigaciones Oncológicas (CNIO)
Madrid
Contenido:
Ponencia en power point
Metilación y cáncer de pulmón
137
138
Cáncer de pulmón
Metilación y cáncer de pulmón
139
140
Cáncer de pulmón
Metilación y cáncer de pulmón
141
142
Cáncer de pulmón
Metilación y cáncer de pulmón
143
144
Cáncer de pulmón
Metilación y cáncer de pulmón
145
146
Cáncer de pulmón
Metilación y cáncer de pulmón
147
148
Cáncer de pulmón
Metilación y cáncer de pulmón
149
150
Cáncer de pulmón
Metilación y cáncer de pulmón
151
152
Cáncer de pulmón
Metilación y cáncer de pulmón
153
Sesión III
PERSPECTIVAS DE LAS NUEVAS TERAPIAS
EN CÁNCER DE PULMÓN
Moderadora: Montserrat Sánchez-Céspedes
DIANAS MOLECULARES
Y NUEVAS TERAPIAS
Rafael Rosell
Institut Català d’Oncologia
Hospital Germans Trias i Pujol
Barcelona
Contenido:
Resumen de la ponencia
Artículos del ponente
Molecular Targets and Novel Therapies
Rafael Rosell
Servicio de oncología médica
Institut Català d’Oncologia
Hospital Germans Trias i Pujol, Barcelona
tandard cancer management consists in the empirical approach of randomized trials without taking
into consideration the predicting role of multiple genetic cancer abnormalities, including gene mutations,
overexpression of anti-apoptotic genes, mutations in pro-apoptotic genes, loss of transcription by promoter
gene hypermethylation. We will focus on our recent findings and the clinical implications of EGFR tyrosine
kinase mutations in lung cancer and the pattern of serum DNA methylation in the promoter of the
14-3-3s gene.
S
Recently, it has been discovered that mutations on the EGFR tyrosine kinase domain confer
enhanced response to EGFR drug inhibitors, but increased resistance to chemotherapy. The potential
relevance of EGFR mutations to NSCLC treatment has recently been identified. In the present study,
laser capture microdissection was performed for the accurate procurement of tumor cells. EGFR exons
18, 19 and 21 and flanking intron sequences were amplified from genomic DNA by means of PCR,
and the samples were then subjected to bidirectional automatic sequencing. So far, 34 gefitinib-treated
patients have been screened, 18 from Japan and 16 from Spain, in addition to 1 cetuximab-treated
Spanish patient and 1 untreated patient. Most of the female patients and non-smokers were Japanese,
while there were more males and more smokers among the Spanish patients. The median number of
prior chemotherapy regimens was 3 in the Spanish and 2 in the Japanese group (P = 0.02). EGFR
mutations were observed in 12.5% of the Spanish patients and in 41% of the Japanese patients
(P = 0.17). 7/9 Japanese gefitinib responders harbored EGFR mutations: 3 missense mutations at exon
18, and 4 in-frame deletions removing amino acids 746 through 750 (ELREA), one of which was a
heterozygous in-frame deletion (747-751) and insertion of phenylalaline residue. The only Spanish gefitinib
responder also harbored a heterozygous in-frame deletion (746-751) and insertion of alanine residue.
Some of the other mutations were homozygous. Although no mutations were found in non-responders,
one was found in a Spanish patient with stable disease who had two primary lung cancers. The mutation
was found in the resected specimen of lung adenocarcinoma but not in the second relapsing primary
squamous cell carcinoma. Missense mutations were also found in the untreated patient and in the
cetuximab-treated responder (L861R). In Japanese patients, mutations were more frequently observed
in patients < 60 years (P = 0.05) and in non-smokers (P = 0.05). Median survival for Japanese patients
with EGFR mutations was 15.6 months from the start of gefitinib treatment, while for the remaining
Japanese patients with wild-type EGFR, it was 2.3 months (P = 0.04). Sequencing analysis is being
performed in additional Spanish, German and Chinese gefitinib-treated patients and in the gefitinibsensitive human NSCLC cell line PC9. Since median survival of Spanish patients with stable disease was
14 months, other genetic alterations are being examined in these patients. EGFR mutations are present
more frequently in Japanese, non-smokers, and patients < 60 years, and can be used as a predictive
marker for EGFR inhibition. In the meaningful number of non-Japanese patients with stable disease, other
markers may predict the relatively good response to EGFR inhibition. Final data will be presented.
Survival in advanced non-small-cell lung cancer patients treated with platinum-based doublets is
rather variable. Methylation-dependent transcriptional silencing of 14-3-3s, a major G2/M checkpoint
Dianas moleculares y nuevas terapias
159
control gene, detected in patient pre-treatment sera, could predict better survival. A sensitive methylationspecific polymerase chain reaction assay was used to evaluate 14-3-3s methylation status in pre-treatment
serum DNA obtained from 115 cisplatin-plus-gemcitabine-treated non-small-cell lung cancer patients.
14-3-3s methylation was observed in all histologic types in 39 patients (34%). After a median followup of 9.8 months, median survival was significantly greater in the methylation-positive group (15.1 versus
9.8 months; P = 0.004 by the log-rank test). Median survival for 22 methylation-positive responders has
not been reached, while it was 11.3 months for 29 methylation-negative responders (P = 0.001). The
risk of death for methylation-negative responders was almost five times greater than that of methylationpositive responders (P = 0.001). Methylation of 14-3-3s can be detected in the pre-treatment sera of
non-small-cell lung cancer patients, obviating the need for tumor tissue and offering a novel method to
predict survival after treatment with platinum-based doublets.
160
Cáncer de pulmón
Overexpression of ERCC1
may play a role in
cisplatin resistance in
non–small-cell lung cancer.
Gary Ernest Smith. Old Road, New Road. Oil on canvas, 40″ × 60″. Courtesy of Raymond E. Johnson's
Overland Gallery of Fine Art, Scottsdale, Arizona.
Nucleotide Excision Repair Pathways
Involved in Cisplatin Resistance in
Non–Small-Cell Lung Cancer
Rafael Rosell, MD, Miquel Taron, PhD, Agusti Barnadas, MD,
Giorgio Scagliotti, MD, Carme Sarries, PhD, and Barbara Roig, PhD
Background: In spite of the growing list of genetic abnormalities identified as being involved in DNA repair
pathways that alter chemosensitivity in non–small-cell lung cancer (NSCLC) patients, translational assays have
not yet been developed for use in individualized chemotherapy.
Methods: In metastatic NSCLC, no single cisplatin-based chemotherapy regimen has been shown to be superior
to any other. Although these studies show a small survival tail at 3 years, the majority of patients had a
median survival of 8 to 10 months. We review the principal mechanisms of cisplatin resistance, particularly
those involved in the nucleotide excision repair (NER) pathways (transcription-coupled repair and global
genomic repair).
Results: ERCC1 is a single-stranded DNA endonuclease that forms a tight heterodimer with xeroderma
pigmentosum complementation group F. It incises DNA on the 5′ side of a lesion such as cisplatin-DNA adduct.
Therefore, overexpression of ERCC1 and other NER enzymes during ovarian cancer chemotherapy with
cisplatin appears to be implicated in the formation of cellular and clinical drug resistance. Recently, baseline
ERCC1 mRNA overexpression has been related to poor response and survival in cisplatin-treated NSCLC
patients.
Conclusions: The level of evidence for many assays is limited, and only ERCC1 mRNA levels have been
analyzed extensively. The impact of ERCC1 should be fully validated in prospective clinical trials.
From the Medical Oncology Service, Hospital Germans Trias i
Pujol, Badalona (Barcelona), Spain (RR, MT, AB, CS, BR), and the
Thoracic Oncology Unit, Department of Clinical and Biological
Sciences, University of Torino, Torino, Italy (GS).
Submitted August 5, 2002; accepted September 30, 2002.
Address reprint requests to Rafael Rosell, MD, Medical Oncology
July/August 2003, Vol. 10, No.4
Service, Hospital Germans Trias i Pujol, Ctra Canyet, s/n, 08916
Badalona (Barcelona), Spain. E-mail: rrosell@ns.hugtip.scs.es
Dr. Scagliotti receives honoraria from Eli Lilly and Co, Aventis
Pharmaceuticals Inc, and AstraZeneca Pharmaceuticals LP. The other
authors report no significant relationship with the companies/organizations whose products or services are referenced in this article.
Cancer Control 297
Introduction
Cisplatin has long been the foundation of
chemotherapy in lung cancer, and the role of noncisplatin combinations has not yet been fully demonstrated. Cisplatin is the platinum agent of choice in the
treatment of germ-cell tumors. On the other hand,
oxaliplatin is effective in colorectal cancer, unlike cisplatin, and shows higher activity in vitro in cancer cell
lines with an impaired DNA mismatch repair (MMR)
system.1 The mechanisms of resistance to cisplatin
have recently been reviewed in depth, illustrating how
multiple proteins and several pathways intervene in
this resistance.1
Although cisplatin or carboplatin are the essential
partners in combination chemotherapy in non–smallcell lung cancer (NSCLC), there are still many paradoxical findings. In a European study, more than 400
patients with stage IIIB (30%) or IV (70%) NSCLC were
randomized to receive cisplatin 100 mg/m2 or a combination of paclitaxel 175 mg/m2 by 3-hour infusion
plus cisplatin 80 mg/m2 every 3 weeks. Although differences in response were observed in favor of the
combination, there were no differences in median survival (8.6 months in the cisplatin arm and 8.1 months
in the combination arm).2 These results are open to
various explanations, ranging from the low paclitaxel
dose to the differences in the cisplatin dose between
the two arms. Similarly, the Cancer and Leukemia
Group B (CALGB) has reported its trial of paclitaxel
250 mg/m2 by 3-hour infusion plus carboplatin at a
dose based on the area under the concentration-time
curve (AUC) of 6 compared with paclitaxel alone at
the same dose. The same phenomena were observed:
significant differences in response and median survival3 in favor of the combination regimen but similar
1-year survival in the two arms.4
In the landmark four-arm Eastern Cooperative
Oncology Group (ECOG) trial in advanced NSCLC, all
four platinum-based combination chemotherapy regimens attained the same pattern of response, median
survival, and 1- and 2-year survival rates. In the control
arm (cisplatin 75 mg/m2 plus paclitaxel 135 mg/m2 by
24-hour infusion), the response rate was 21%, median
survival was 7.8 months, 1-year survival was 31%, and 2year survival was 10%. Similar results were observed in
patients treated with cisplatin plus gemcitabine, cisplatin plus docetaxel, and carboplatin plus paclitaxel5
(Table 1).
In the three-arm Italian Lung Cancer Project trial,
patients were randomized to receive gemcitabine plus
cisplatin or paclitaxel plus carboplatin or vinorelbine
plus cisplatin. Again, no differences in response rate
(30%), time to progression (4.6 months), or median survival (9.8 months) were observed.6 However, in the
first trial comparing cisplatin plus paclitaxel vs carboplatin plus paclitaxel, differences in time to progression
(4.2 vs 3 months; P=.03) and median survival (9.8 vs
8.2 months; P=.01) were observed in favor of the cisplatin arm7 (Table 1).
These results can be interpreted as a reflection of
the failure of chemotherapy in advanced NSCLC, which
seems unable to progress beyond the frontier of 8month median survival. However, the ECOG trial5 has
ushered in a new era in cancer management that will
include not only the concepts of new therapeutic targets, chemoprevention, and spiral computed tomography screening,8 but also the genetic bases of chemoresistance, which can pave the way for tailored
chemotherapy. Cisplatin damages DNA, inducing the
formation of chemically stable DNA adducts. The
absence of measurable cisplatin DNA adducts, determined by enzyme-linked immunosorbent assay (ELISA),
Table 1. — Outcomes in Selected Non–Small-Cell Lung Cancer Trials
Response Rate
Survival
Median (mos)
1 Year
Median Time
to Progression (mos)
Schiller et al5
Pac/cis
Gem/cis
Docetaxel/cis
Pac/carbo
21%
22%
17%
17%
7.8
8.1
7.4
8.1
31%
36%
31%
34%
3.4*
4.2*
3.7
3.1
Scagliotti et al6
Vrb/cis
Gem/cis
Pac/carbo
30%
30%
32%
9.5
9.8
10.0
37%
37%
43%
4.6
5.3
5.5
Pac/cis = paclitaxel/cisplatin
Gem/cis = gemcitabine/cisplatin
Pac/carbo = paclitaxel/carboplatin
Vrb/cis = vinorelbine/cisplatin
* Significant difference in time to progression between the paclitaxel/cisplatin control arm and the gemcitabine/cisplatin arm (P=.001).
298 Cancer Control
July/August 2003, Vol. 10, No.4
is associated with poor outcome. In one study, multiple
tissues, including ovarian tumor, were obtained at autopsy from 8 patients who had received either cisplatin or
carboplatin chemotherapy. Cisplatin DNA adducts were
detected in most of the tissues examined, and DNA
adduct levels were similar in the majority of tissues from
the same subject, whether taken from the bone marrow,
liver, brain, or peripheral nerve.9 The assessment of
DNA adduct levels could become one predictive assay
for cisplatin and/or radiotherapy. Schaake-Koning et al10
observed an improvement in survival in patients with
locally advanced NSCLC who were treated with daily
radiotherapy plus daily cisplatin 6 mg/m2 approximately 1 hour before irradiation (20 administrations for a
total of 120 mg/m2), compared with radiotherapy alone.
Three-year survival was 16% for concomitant cisplatinradiotherapy vs 2% for radiotherapy alone.
Differences in survival according to cisplatin DNA
adduct levels have been observed in patients treated
with concomitant cisplatin and radiotherapy. Dutch
investigators studied 27 patients treated with daily cisplatin and radiotherapy.11 To assess cisplatin DNA
adduct levels, buccal cells were collected by wiping the
inner cheek with a cotton swab before cisplatin treatment and 1 hour after the fifth course of cisplatin. The
immunohistochemical method used for cytospins
enabled cisplatin DNA adducts to be visualized in
nuclei of the buccal cells. Nuclear signal intensity (arbitrary units) ranged from 0.4 to 2.8. Striking differences
in survival were observed according to DNA adduct levels. Thirteen patients with low DNA adduct levels
(≤1.16) had a median survival of 5.2 months compared
to 14 patients with high levels (>1.16), who had a median survival of 30.2 months (P<.0001). If these data are
validated in a large-scale study, cisplatin DNA adduct
levels could be used to identify the nearly 50% of
patients who could obtain the greatest benefit from a
concomitant cisplatin-radiotherapy approach and
enable us to look for a different therapy for the 50%
who would not benefit from such an approach.
Several molecular assays can be used to tailor
chemotherapy in the care of lung cancer patients.
Accumulated evidence indicates that several genetic
markers are related to cisplatin resistance, and current
research is providing hints that predictive markers may
also affect resistance to gemcitabine and/or microtubule-interacting drugs.
DNA Repair
Cell repair capacity is stored in the linear sequence
of approximately 3 × 109 copies of the four bases —
guanine, cytosine, adenine and thymine — aligned in
July/August 2003, Vol. 10, No.4
the DNA. A growing number of reports identify DNA
damage with the regulation of DNA repair gene transcription and the control of cell cycle progression and
apoptosis via DNA damage checkpoints. Different
pathways of DNA repair are polymorphic and vary
interindividually and with age. These features influence
the chemosensitivity of tumor cells toward DNA-reactive cytotoxic drugs.
DNA repair is a counteragent in carcinogenesis and
an accomplice in cancer therapy resistance.12 There are
several major DNA repair pathways. Excision repair,
including nucleotide excision repair (NER), has been
strongly linked to cisplatin resistance. Base excision
repair (BER) also plays an important role in chemotherapy resistance. The mRNA levels of the excision repair
cross-complementing (ERCC1) gene, involved in the
NER pathway, have recently been found to be closely
correlated with levels of 8-oxoguanine DNA glycosylase
(OGG1), involved in the BER pathway. The repair of
double-strand breaks, induced by cytotoxic agents,
radiotherapy, and reactive oxygen species, is carried out
by homologous recombination and nonhomologous
DNA end joining. Other pathways are MMR and onestep repair (OSR), meaning the direct reversal of DNA
damage. The repair protein O6-alkylguanine-DNA alkyltransferase, also known as O6-methylguanine-DNA
methyltransferase (MGMT), intervenes in OSR through
removal of an alkyl group from the O6-atom of guanine
in the DNA of cells exposed to alkylating agents. With
increasing size of the alkyl group, the relative contribution of MGMT to the repair of O6-alkylguanines in DNA
decreases and excision repair becomes more relevant.12
As an example of OSR, treatment with chloroethylnitrosourea (BCNU) correlates with MGMT activity; in the
process of cytotoxic interstrand cross-links in target cell
DNA, BCNU initially alkylates the O6-atom of guanine.
Intriguingly, MGMT levels vary greatly among tumors,
which has been used in pharmacogenomic interpretation. Hypermethylation of MGMT (abrogating OSR) was
observed in 40% of brain tumors treated with BCNU and
was related to significantly better survival.13 Interestingly, the activity of temozolomide has been linked to
tumor MGMT. However, when temozolomide was combined with CPT-11, this mechanism of resistance was
circumvented in tumor cells that were either MGMT
proficient or MMR deficient.14
The possibility of individualizing DNA repair profiles is becoming a central issue in the search for
improved chemotherapy results. Current bioinformatics tools for microarray data have correlated gene
expression profiles in cell lines with response to
chemotherapy, leading to the identification of genes
that may be important for drug sensitivities. However,
profiling with microarray requires relatively large
Cancer Control 299
quantities of RNA, making the process inappropriate
for certain applications. Cancer cells accumulate multiple genetic abnormalities in signal transduction pathways during carcinogenesis and cancer progression.
NER deficiencies are related to lung oncogenesis yet
simultaneously confer a chemotherapy advantage.
Like many DNA alkylators, cisplatin acts as a cross-linker, inhibiting DNA replication, which is the critical target in cancer chemotherapy. Cross-links between guanine bases are induced by cisplatin, carboplatin, and
oxaliplatin. Cisplatin and carboplatin form an identical
cross-link, while the oxaliplatin cross-link is structurally different due to the bulky 1,2-diaminocyclohexane
group in the adduct.15 The mechanisms of DNA repair
have been investigated in depth, primarily the nuclear
DNA repair pathways involving BER, recombination,
MMR, NER, and OSR. Mitochondrial DNA repair pathways can also play an important role and are reviewed
elsewhere.16 In this review, we focus primarily on the
NER pathway.
DNA Repair Capacity, Lung Cancer
Risk, and Chemoresistance
Many cancer chemotherapeutic agents, including
cisplatin, cause interstrand cross-links, which
accounts for their therapeutic cytotoxic properties.
Similarly, many carcinogens are bifunctional, causing
both monoadducts and intrastrand or interstrand
cross-links in DNA. DNA repair capacity (DRC) is
genetically determined; it modulates lung cancer susceptibility and treatment response.17 Carcinogeninduced DNA damage induces breaks in the sugarphosphate DNA backbone, either in one or both of
the two strands of the double helix. Covalent binding
of the carcinogen results in the formation of a chemically altered base in DNA that is called an adduct. A
nucleotide adduct is a fragment consisting of carcinogen-base-deoxyribose-phosphate, a nucleoside adduct
consists of carcinogen-base-deoxyribose, and a base
adduct is the carcinogen-modified base only. DRC has
been assessed in peripheral blood lymphocytes by the
host-cell reactivation assay, which measured cellular
reactivation of a reporter gene damaged by exposure
to 75 µm benzo[a]pyrene diol epoxide (BPDE).18
With this functional assay, the mean level of DRC was
significantly lower in patients with lung cancer than
in controls. Younger cases (<65 years of age) and
smokers were more likely than controls to have
reduced DRC.18 BPDE-induced DNA adducts are
repaired by the NER pathway, in which ERCC1 plays a
pivotal role, raising the hypothesis that lung cancer
patients with lower ERCC1 levels — and thus lower
DRC — may have enhanced response and survival
with cisplatin-based chemotherapy.
300 Cancer Control
In an experimental model, elevated DRC was associated with resistance to cisplatin in lung cancer cell
lines.19 In this case, the overall DRC was estimated
based on the ability of cells to reactivate the pRSV-CAT
(chloramphenicol acetyltransferase) plasmid damaged
by cisplatin. The pRSV-CAT plasmid contains the bacterial gene for CAT under the control of the RSV longterminal repeat promoter. Platination of the pRSV-CAT
plasmid will diminish or abolish CAT gene expression
as a consequence of DNA damage after transfection
into cells. Repair of these lesions will restore CAT gene
expression and provide information about the overall
repair capacity of a given cell population. NSCLC cells
were found to be significantly more resistant to cisplatin than small-cell cancer cell lines isolated from
untreated patients.19
The epidemiology of DRC and its effect on cancer
susceptibility has been fully developed. In 1998, 64
reports addressed the association of cancer susceptibility with defects in DRC.20 Several assays of DRC have
been used. With the host-cell reactivation assay,DRC has
been measured in peripheral blood lymphocytes with
the host-cell reactivation assay and calculated as the percentage of residual CAT gene expression after the repair
of ultraviolet radiation- or cisplatin-damaged plasmid
DNA divided by that in undamaged plasmid DNA. The
host-cell reactivation assay measuring the activity of the
CAT gene has been used in cells transfected with BPDEtreated plasmid. Because a single unrepaired DNA
adduct can effectively block CAT transcription, any CAT
activity will reflect the ability of the transfected cells to
remove BPDE-induced adducts from the plasmids. The
most susceptible subgroup of cigarette smokers on the
basis of their low DRC were case patients who were
young (<60 years if age), female, or light smokers, or
who reported a family history of cancer. In contrast, in
a study comparing 316 newly diagnosed lung cancer
patients and 316 cancer-free control subjects, heavy
smokers among both case patients and control subjects
tended to have more proficient DRC than lighter smokers, suggesting that cigarette smoking may stimulate
DRC in response to the DNA damage caused by tobacco carcinogens.20 Similarly, women smokers with the
GSTM1 null genotype, which results in diminished glutathione S-transferase (GST) activity, had the greatest
lung cancer risk compared with other groups of women
and men with different GSTM1 genotypes. The absence
of detoxifying GST activity may result in an excess of
internal exposure to tobacco carcinogens, leading to a
higher level of DNA damage or adduct formation.21
In short, defective DRC is one of the major factors
responsible for carcinogenesis, and at the same time, it
can confer a favorable cytotoxic effect. Preliminary
hints as to the therapeutic benefit of deficient DRC
July/August 2003, Vol. 10, No.4
stem from molecular epidemiology studies assessing
the DRC by the host-cell reactivation assay in lymphocytes, which measures the NER capacity.22 As stated
above, one determinant of the level of cisplatin DNA
adducts in host tissues (cancer patients) treated with
cisplatin-based chemotherapy is the rate of DNA repair.
Subjects vary considerably in their capacity to remove
DNA adducts.18 It is thought that NER is the primary
mechanism for repairing cisplatin DNA adducts. The
relationship between DRC and survival in patients with
NSCLC treated with cisplatin-based chemotherapy was
recently examined.22 In this study, patients who had
received chemotherapy were divided into quartiles
according to their DRC. Patients in the top quartile
(DRC >9.2%) had a risk of death that was more than
two times the risk of death for patients in the bottom
quartile (DRC <5.8%; P=.01). Median survival was 8.9
months for patients in the top quartile compared with
15.8 months for those in the bottom quartile (P=.04).
Intriguingly, among the 36 chemonaive patients who
underwent curative surgical resection, there was a
slight survival advantage associated with increased
DRC. This finding could be relevant when interpreting
the results of neoadjuvant chemotherapy trials in early
NSCLC. The assessment of DRC, either by measuring
cisplatin DNA adducts, the host-cell reactivation assay,
or the overexpression of ERCC1 gene transcript, is warranted in such trials to identify the subgroup of patients
with low DRC, who could have lower survival when
treated with surgery alone and at the same time could
benefit from neoadjuvant or adjuvant chemotherapy. In
contrast, patients with high DRC could have better survival when treated with surgery alone and could be
refractory to neoadjuvant or adjuvant approaches.
NER Capacity and Cisplatin Effect
It is a common belief that cisplatin exerts its cytotoxic effect by disrupting the DNA macromolecule,
mainly through the formation of intrastrand adducts
and interstrand cross-links that are repaired through
the NER pathway. It is also postulated that tumors that
are defective in MMR become more resistant to cisplatin than their MMR-proficient counterparts. The
NER pathway consists of several steps: damage recognition, dual incision/excision, repair synthesis, and ligation. Approximately 30 proteins participate in this
repair process; above all, ERCC1 has a crucial role in
the incision process, which is the rate-limiting step of
the pathway. ERCC1 is a 15-kb repair gene located on
human chromosome 19. ERCC1 forms a heterodimer
with XPF, and the ERCC1/XPF complex is responsible
for the incision to cleave the damaged strand at the
phosphodiester bonds between 22 and 24 nucleotides
5′ to the lesion.
July/August 2003, Vol. 10, No.4
Functional ERCC1 is important in the repair of cisplatin DNA adducts and in cisplatin sensitivity in intact
cells.23 ERCC1 mRNA levels, measured by quantitative
polymerase chain reaction (PCR), were examined in
gastric cancer patients treated with cisplatin/fluorouracil (FU). Before chemotherapy, cDNA was
obtained from primary gastric tumors, and ERCC1
mRNA levels were expressed as the ratio of the PCR
product of the ERCC1 gene and the β-actin housekeeping gene. The median ERCC1 mRNA level for the 17
responders was 4.9, while the median ERCC1 mRNA
level for the 16 resistant patients was 8. The difference
between responders and nonresponders was statistically significant.23 The median survival for patients
with ERCC1 mRNA levels <5.8 was not reached at the
time the report was published, while the median survival for those with levels >5.8 was only 5.4 months.
The difference was highly significant, disclosing for the
first time that intratumoral levels of ERCC1 mRNA
influence the outcome of gastric cancer patients treated with cisplatin/FU.23 This study gave no conclusive
results on whether ERCC1 mRNA levels could be an
independent predictive marker for cisplatin benefit.
Originally, ERCC1 mRNA levels were assessed in ovarian cancer tissue harvested from 28 patients before
treatment with carboplatin- or cisplatin-based chemotherapy. RT-PCR–based assay was used to determine
the level of expression of ERCC1 and β-actin, as well as
human xeroderma pigmentosum group A correcting
(XPAC) gene. Numerical values for the expression of
the ERCC1 and XPAC genes in the ovarian tumor tissue
samples were obtained using the densitometric readout of the autoradiographic signal generated by the
32 P-labeled ERCC1 or XPAC probe divided by the
densitometric reading for β-actin. In this case, the
numerical values were different from those reported
in the literature using quantitative PCR. Thirteen nonresponders showed greater levels of ERCC1 mRNA
than 15 responders.24
The cisplatin effect on ERCC1 mRNA expression
has been examined in vitro. In response to a 1-hour
cisplatin exposure, human ovarian cancer cells
showed a two- to six-fold increase in steady-state levels
of ERCC1 mRNA over basal expression levels.25,26 A
positive association has also been demonstrated
between the level of ERCC1 mRNA expression and the
amount of cisplatin-DNA adduct repair in ovarian
tumor cells in vitro.26
Intriguingly, ERCC1 antisense RNA abrogates the
gemcitabine-mediated cytotoxic synergism with cisplatin in human colon tumor cells that were proficient
in NER. Experimental results indicate that stable
expression of ERCC1 antisense mRNA downregulates
the level of mRNA and repair activity. The downregulaCancer Control 301
tion of the repair activity significantly correlates with
the reduction of the cytotoxic synergism between gemcitabine and cisplatin.27
Along the same lines, ERCC1 mRNA levels have
been correlated with oxaliplatin resistance in colorectal cancer patients. Median survival for patients with
ERCC1 expression <4.9 was 10 months, while for
patients with ERCC1 expression >4.9, it was 1.9
months.28 These findings indicate that intratumoral
ERCC1 mRNA may be an independent predictive marker for oxaliplatin combination chemotherapy. Both this
study and the original study in gastric cancer23 were
conducted by investigators from the University of
Southern California (USC)/Norris Comprehensive
Cancer Center and Response Genetics. ERCC1 mRNA
levels have not been correlated with noncisplatin
chemotherapy response. When the correlation
between the expression of eight genes involved in NER
and DRC was examined, only ERCC1 and XPD mRNA
levels were highly correlated both with each other and
with DRC.29 ERCC1 and XPD (also known as ERCC2)
are closely linked on chromosome 19q13.2-13.3. More
recently, the same investigators observed a strong correlation between ERCC1 and OGG1 mRNA levels in
peripheral lymphocytes. OGG1 encodes the 8-oxoguanine-DNA glycosylase, which removes 8-oxoguanine
from DNA as part of the BER pathway.30 XPD polymorphism has been related to lower DRC.31 Approximately half of the population examined had the genotype Lys751Lys and also had Asp312Asp. These patients
had a good DRC and therefore are presumably resistant
to cisplatin. In an epidemiological study matching 341
lung cancer cases with 360 smoker control subjects, a
host-cell reactivation assay measuring the activity of the
CAT gene was used in cells transfected with plasmids
treated with BPDE. DRC was lower in the lung cancer
patients than in the controls. The variants Gln751Gln
and Asn312Asn had suboptimal DRC, with a significant
increase in the hazard ratio, in contrast with the wildtype genotypes both in cases and controls, which
exhibited the most proficient DRC.31 The frequency of
homozygous variants was 10% for either codon. In an
intermediate group with heterozygous polymorphisms,
the frequency was 40% at either codon.
The clinical interest of these findings lies in their
potential usefulness in identifying in constitutional
DNA from lymphocytes the polymorphisms associated
with suboptimal DRC and their potential role in identifying patients with better response to cisplatin
chemotherapy.
UV light, BPDE DNA adducts, and cisplatin DNA
adducts are effective blocks to RNA polymerase II and
thus block transcription. These DNA lesions are
302 Cancer Control
removed by NER, which is split into subpathways: transcription-coupled repair (TCR) and global genomic
repair (GGR). Importantly, TCR repairs transcriptionblocking lesions in transcribed DNA strands of active
genes, whereas GGR repairs the lesions in the nontranscribed strand of active genes and nontranscribing
genome.32 When transcribing RNA polymerase II
encounters the lesion, two TCR-specific factors, CSA
and CSB, are implicated for the activation of the common NER molecular pathway.32 The clinical implications of TCR lie in the fact that cisplatin-resistant
tumors show an intact TCR system, while tumors are
sensitive to cisplatin when the TCR subpathway is deficient. For GGR, the xeroderma pigmentosum group C
(XPC) complex is activated. Along with the basal transcription factor (TFIIH), an XPG binds to the DNA
around the lesion. TFIIH contains two helicases, XPB
and XPD, which open approximately a 30-base-long
DNA segment around the damage. This open intermediate is stabilized by replication protein A and XPA. The
DNA strand that contains the damaged base(s) is
excised by the two NER endonucleases, XPG and
XPF/ERCC1. XPG cleaves the damaged DNA strand 3′
from the lesion, and XPF/ERCC1 cleaves the damaged
strand 5′ from the DNA lesion. Finally, the resulting gap
is filled in by DNA polymerases in the presence of replication factors. Molecular deficiencies (in both GGR
and TCR subpathways) in primary fibroblasts confer
marked hypersensitivity to cisplatin compared to normal primary fibroblasts. These results demonstrate that
any one deficiency in XPA, XPD, XPF, or XPG confers
marked hypersensitivity to cisplatin.32
ERCC1 Expression
We have analyzed the role of ERCC1 expression in
metastatic NSCLC patients treated with gemcitabine/
cisplatin. mRNA was isolated from paraffin-embedded
primary tumor specimens obtained by bronchoscopy
biopsy. The median ERCC1 expression in 56 patients
analyzed relative to the expression of the control βactin was 6.7. Patients with ERCC1 expression above
6.7 had a median survival of 5 months, while those with
lower levels had a median survival of 15 months. This
difference was statistically significant, and importantly,
in a Cox multivariable analysis, ERCC1 levels surfaced
as an independent predictive variable. The fact that the
cutoff was higher than previously described indicates
that a certain level of ERCC1 is required for synergism
between gemcitabine and cisplatin.33
The potential role of the 5′-untranslated region (5′UTR) in ERCC1 mRNA expression has also been examined. RT-PCR was carried out with primers targeting
the 5′-UTR to amplify a fragment containing exon I
July/August 2003, Vol. 10, No.4
(UTR) and exon II (containing the initiation codon) of
the ERCC1 gene in 121 ovarian cancer samples. Interestingly, two PCR amplimers from the same sample for
the target segment within the UTR appeared in some
samples. The prevalence of the two amplimers
occurred in the group of patients with high ERCC1
mRNA levels (48%). In contrast, only 5% of patients
with a single amplimer showed high ERCC1 mRNA levels. Direct DNA sequencing of the cDNA from each of
the 121 ovarian cancer tumor samples confirmed that
tumors with two amplimers contained two distinct
sequences. The longer sequences included the complete target sequence, 261-bp (wild type), and the
shorter sequences demonstrated a 42-bp deletion.34
This 42-bp deletion seems to be associated with high
ERCC1 mRNA levels.
enhanced in some cisplatin-resistant cell lines.40 Multidrug resistance protein 2 (MRP2) is also a putative cisplatin efflux pump.41 Other mechanisms involve cisplatin detoxification by glutathione/glutathione acetylS-transferases (GSH/GST). The four major GST-related
genes (GSTP1, GSTT1, GSTM1, and GSTZ1) attach
reduced glutathione to electrophilic groups in a wide
variety of toxic compounds, including chemotherapeutic agents, and GSTP1 overexpression has been correlated with increased cisplatin resistance.42 Recently,
the GSTP1 Ile105 Val polymorphism has been associated with increased survival in patients with advanced
colorectal cancer receiving FU/oxaliplatin chemotherapy.43 This polymorphism has been related to substantially diminished GSTP1 enzyme activity, reducing the
detoxification pathway mediated by GSTP1.44
Overall, ERCC1 stands out as a potential predictive
marker for cisplatin-based chemotherapy and it could
be the basis for customized chemotherapy.
Metallothioneins are also involved in low cisplatinadduct formation. Metallothioneins are metal binding
proteins of low molecular weight; they are cysteine
rich and have an important role in the homeostasis of
trace metals and in the detoxification of metals such as
Cd2+ and Hg2+. Metallothioneins are transcriptionally
induced by these metals through metal-responsive elements located in the 5′-regulatory regions of human
methallothionein genes. Overexpression of methallothionein has been correlated with cisplatin-resistance, and transfection of the gene encoding for methallothionein increases cisplatin resistance.45
Other Genetic Markers Conferring
Cisplatin Resistance
Defects in DNA MMR may result from mutation or
methylation-mediated silencing of three mismatch
repair genes: hMLH-1, hMSH-2, or hPMS-2. These
defects have been shown to be a mechanism of resistance to cisplatin but not to oxaliplatin both in vivo and
in vitro.35 It is thought that an MMR complex recognizes cisplatin-DNA adducts but not oxaliplatin-DNA
adducts, and that MMR proteins are involved in mediated response to DNA damage.35,36 This has been demonstrated in experiments using MMR-proficient and MMRdeficient cells, where different DNA repair pathways
have been linked to cisplatin but not to oxaliplatin.37,38
In addition to members of the MMR family, other
proteins also interact with cisplatin DNA adducts,
including numerous nuclear proteins binding to cisplatin DNA adducts, such as linker histones H1, high
mobility group 1 (HMG1) box-containing proteins, and
many different transcription factors. HMG1 is a nonhistone chromosomal protein that appears to be involved
in DNA replication and repair. HMG1 was overexpressed in three cisplatin-resistant cell lines. The
expression of HMG1 is increased at the transcriptional
level, which may be due to enhanced activity of the
CCAAT-binding transcription factor/nuclear factor 1
(CTF/NF-1).39
Other mechanisms of cisplatin resistance involve
decreased net intracellular accumulation of cisplatin.
ATP-dependent pathways activate outward efflux of
cisplatin through the plasma membrane, which is
July/August 2003, Vol. 10, No.4
BRCA1 plays an important role in DNA damage
repair mediated-cisplatin sensitivity.46 Increased levels
of BRCA1 have been observed in cisplatin-resistant
breast and ovarian carcinoma cell lines derived from
MCF7 and SKOV3. Furthermore, antisense inhibition of
BRCA1 in SKOV3 cisplatin-resistant cell lines resulted in
increased sensitivity to cisplatin, decreased DRC, and
increased apoptosis. BRCA1 and Rad5116 co-localize
and interact in the S-phase of the cell cycle.47
Conclusions
Preclinical data indicate that TCR is involved in cisplatin resistance. However, clinical findings, with a
level of evidence of 2 (positive phase II studies), have
focused on ERCC1, which is involved in GGR. Further
research is required to validate ERCC1 mRNA levels in
randomized trials, and customized chemotherapy trials
including ERCC1 assessment are ongoing. However, an
important limitation is the availability of tumor samples. Stage IV NSCLC is often diagnosed through cytology, which can impede ERCC1 assessment. In addition,
in some instances, the amount of tumor tissue in
bronchial biopsies is scarce. Another test to assess the
GGR pathway is the host-cell reactivation assay, which
Cancer Control 303
Table 2. — Predictive Tests Considered for Use in
Cisplatin-Based Customized Chemotherapy Trials
Marker
ERCC1
Damaged CAT reporter genes
repaired in test lymphocytes
transfected with BPDEtreated plasmids
Assay
Level of
Evidence
cDNA quantitation
2
Host-cell reactivation
2
Cisplatin-DNA adducts
Immunohistochemistry
2
Ap endonuclease
Immunohistochemistry
3
Genotyping
2/3
XPD polymorphisms
examines the ability to repair BPDE-induced DNA
adducts in peripheral lymphocytes. Like the assessment of ERCC1, this test has a level of evidence of 2. A
third test is the measurement of cisplatin-DNA adducts
in nuclei of buccal cells, which also has a level of evidence of 2. The only limitation for this method is that
it requires at least the prior administration of one cycle
of cisplatin-based chemotherapy.
Cisplatin-DNA
adducts can be detected a few days after the first cycle,
and the results can be used by the medical oncologist
when deciding whether to continue with cisplatin or
switch to a noncisplatin regimen in those cases with
poor nuclear signal intensity (Table 2).
The role of adjuvant chemotherapy has not yet
been demonstrated in NSCLC, and there are some hints
that patients with proficient GGR can have better
prognosis — though paradoxically, proficient GGR can
cause resistance to cisplatin-based adjuvant chemotherapy. The assessment of ERCC1 in surgical samples
could be used to select patients with low ERCC1
levels who could most benefit from adjuvant chemotherapy. Along the same lines, apurinic/apyrimidinic
endonuclease (Ap endo) is a key DNA repair enzyme
that confers resistance to radiotherapy and alkylating
drugs. Ap endo is crucial in the BER pathway. High
nuclear Ap endo expression correlated with better
survival in surgically resected NSCLC patients.48 At the
same time, it is reported to be a mechanism of resistance to alkylating agents.49 Finally, XPD polymorphisms can be examined in constitutional DNA, and for
this reason, lymphocytes from peripheral blood are a
practical source of DNA. The level of evidence for this
test is 2/3 (ie, little clinical evidence).
References
1. Guminski AD, Harnett PR, deFazio A. Scientists and clinicians
test their metal-back to the future with platinum compounds. Lancet
Oncol. 2002;3:312-318.
2. Gatzemeier U, von Pawel J, Gottfried M, et al. Phase III comparative study of high-dose cisplatin versus a combination of paclitaxel and cisplatin in patients with advanced non-small-cell lung cancer. J Clin Oncol. 2000;18:3390-3399.
304 Cancer Control
3. Lilenbaum RC, Herndon J, List M, et al. Single-agent (SA) versus combination chemotherapy (CC) in advanced non-small cell lung
cancer (NSCLC): a CALGB randomized trial of efficacy, quality life
(QOL), and cost-effectiveness. Proc Annu Meet Am Soc Clin Oncol.
2002;21:2. Abstract.
4. Garfield D. Two drugs better than one for NSCLC. Lancet
Oncol. 2002;3:389.
5. Schiller JH, Harrington D, Belani CP, et al. Comparison of four
chemotherapy regimens for advanced non-small-cell lung cancer. N
Engl J Med. 2002;346:92-98.
6. Scagliotti GV, De Marinis F, Rinaldi M, et al. Phase III randomized trial comparing three platinum-based doublets in advanced nonsmall cell lung cancer. J Clin Oncol. 2002;20:4285-4291.
7. Rosell R, Gatzemeier U, Betticher DC, et al. Phase III randomised trial comparing paclitaxel/carboplatin with paclitaxel/cisplatin in patients with advanced non-small cell lung cancer: a cooperative multinational trial. Ann Oncol. 2002;13:1539-1549.
8. Carney DN. Lung cancer: time to move on from chemotherapy. N Engl J Med. 2002;346:126-128.
9. Poirier MC, Reed E, Litterst CL, et al. Persistence of platinumammine-DNA adducts in gonads and kidneys of rats and multiple tissues from cancer patients. Cancer Res. 1992;52:149-153.
10. Schaake-Koning C, van den Bogaert W, Dalesio O, et al. Effects
of concomitant cisplatin and radiotherapy on inoperable non-smallcell lung cancer. N Engl J Med. 1992;326:524-530.
11. van de Vaart PJ, Belderbos J, de Jong D, et al. DNA-adduct levels as a predictor of outcome for NSCLC patients receiving daily cisplatin and radiotherapy. Int J Cancer. 2000;89:160-166.
12. Rajewsky MF, Müller R. DNA repair and the cell cycle as targets in cancer therapy. In: Alison M, ed. The Cancer Handbook. London: Nature Publishing Group; 2002:1507-1519.
13. Esteller M, Garcia-Foncillas J, Andion E, et al. Inactivation of
the DNA-repair gene MGMT and the clinical response of gliomas to
alkylating agents. N Engl J Med. 2000;343:1350-1354.
14. Houghton PJ, Stewart CF, Cheshire PJ, et al. Antitumor activity
of temozolomide combined with irinotecan is partly independent of
O6-methylguanine-DNA methyltransferase and mismatch repair phenotypes in xenograft models. Clin Cancer Res. 2000;6:4110-4118.
15. Siddik ZH. Mechanisms of action of cancer chemotherapeutic agents: DNA-interactive alkylating agents and antitumour platinum-based drugs. In: Alison M, ed. The Cancer Handbook. London:
Nature Publishing Group; 2002:1295-1313.
16. Kohn KW, Bohr VA. Genomic instability and DNA repair. In:
Alison M, ed. The Cancer Handbook. London: Nature Publishing
Group; 2002:87-106.
17. Phillips DH. The formation of DNA adducts. In: Alison M, ed.
The Cancer Handbook. London: Nature Publishing Group; 2002:
293-307.
18. Wei Q, Cheng L, Hong WK, et al. Reduced DNA repair capacity in lung cancer patients. Cancer Res. 1996;56:4103-4107.
19. Zeng-Rong N, Paterson J,Alpert L, et al. Elevated DNA repair
capacity is associated with intrinsic resistance of lung cancer to
chemotherapy. Cancer Res. 1995;55:4760-4764.
20. Wei Q, Cheng L,Amos CI, et al. Repair of tobacco carcinogeninduced DNA adducts and lung cancer risk: a molecular epidemiologic study. J Natl Cancer Inst. 2000;92:1764-1772.
21. Berwick M,Vineis P. Markers of DNA repair and susceptibility to cancer in humans: an epidemiologic review. J Natl Cancer Inst.
2000;92:874-897.
22. Bosken CH,Wei Q,Amos CI, et al. An analysis of DNA repair
as a determinant of survival in patients with non-small-cell lung cancer. J Natl Cancer Inst. 2002;94:1091-1099.
23. Metzger R, Leichman CG, Danenberg KD, et al. ERCC1 mRNA
levels complement thymidylate synthase mRNA levels in predicting
response and survival for gastric cancer patients receiving combination cisplatin and fluorouracil chemotherapy. J Clin Oncol. 1998;16:
309-316.
24. Dabholkar M, Vionnet J, Bostick-Bruton F, et al. Messenger
RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate
with response to platinum-based chemotherapy. J Clin Invest.
1994;94:703-708.
25. Li Q, Gardner K, Zhang L, et al. Cisplatin induction of ERCC1 mRNA expression in A2780/CP70 human ovarian cancer cells. J
Biol Chem. 1998;273:23419-23425.
July/August 2003, Vol. 10, No.4
26. Li Q,Yu JJ, Mu C, et al. Association between the level of ERCC1 expression and the repair of cisplatin-induced DNA damage in
human ovarian cancer cells. Anticancer Res. 2000;20:645-652.
27. Yang LY, Li L, Jiang H, et al. Expression of ERCC1 antisense
RNA abrogates gemcitabine-mediated cytotoxic synergism with cisplatin in human colon tumor cells defective in mismatch repair but
proficient in nucleotide excision repair. Clin Cancer Res.
2000;6:773-781.
28. Shirota Y, Stoehlmacher J, Brabender J, et al. ERCC1 and
thymidylate synthase mRNA levels predict survival for colorectal cancer patients receiving combination oxaliplatin and fluorouracil
chemotherapy. J Clin Oncol. 2001;19:4298-4304.
29. Vogel U, Dybdahl M, Frentz G, et al. DNA repair capacity:
inconsistency between effect of over-expression of five NER genes
and the correlation to mRNA levels in primary lymphocytes. Mutat
Res. 2000;461:197-210.
30. Vogel U, Moller P, Dragsted L, et al. Inter-individual variation,
seasonal variation and close correlation of OGG1 and ERCC1 mRNA
levels in full blood from healthy volunteers. Carcinogenesis.
2002;23:1505-1509.
31. Spitz MR,Wu X,Wang Y, et al. Modulation of nucleotide excision repair capacity by XPD polymorphisms in lung cancer patients.
Cancer Res. 2001;61:1354-1357.
32. Furuta T, Ueda T, Aune G, et al. Transcription-coupled
nucleotide excision repair as a determinant of cisplatin sensitivity of
human cells. Cancer Res. 2002;62:4899-4902.
33. Lord RV, Brabender J, Gandara D, et al. Low ERCC1 expression
correlates with prolonged survival after cisplatin plus gemcitabine
chemotherapy in non-small cell lung cancer. Clin Cancer Res.
2002;8:2286-2291.
34. Yu JJ, Thornton K, Guo Y, et al. An ERCC1 splicing variant
involving the 5′-UTR of the mRNA may have a transcriptional modulatory function. Oncogene. 2001;20:7694-7698.
35. Fink D, Zheng H, Nebel S, et al. In vitro and in vivo resistance
to cisplatin in cells that have lost DNA mismatch repair. Cancer Res.
1997;57:1841-1845.
36. Fink D, Aebi S, Howell SB. The role of DNA mismatch repair
in drug resistance. Clin Cancer Res. 1998;4:1-6.
37. Nehme A, Baskaran R, Nebel S, et al. Induction of JNK and
cAbl signalling by cisplatin and oxaliplatin in mismatch repair-proficient and -deficient cells. Br J Cancer. 1999;79:1104-1110.
38. Vaisman A, Varchenko M, Umar A, et al. The role of hMLH1,
hMSH3 and hMSH6 defects in cisplatin and oxaliplatin resistance:
correlation with replicative bypass of platinum-DNA adducts. Cancer
Res. 1998;58:3579-3585.
39. Nagatani G, Nomoto M, Takano H, et al. Transcriptional activation of the human HMG1 gene in cisplatin-resistant human cancer
cells. Cancer Res. 2001;61:1592-1597.
40. Fujii R, Mutoh M, Sumizawa T, et al. Adenosine triphosphatedependent transport of leukotriene C4 by membrane vesicles prepared from cisplatin-resistant human epidermoid carcinoma tumor
cells. J Natl Cancer Inst. 1994;86:1781-1784.
41. Taniguchi K, Wada M, Kohno K, et al. A human canalicular
multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant human cancer cell lines with decreased
drug accumulation. Cancer Res. 1996;56:4124-4129.
42. Ban N, Takahashi Y, Takayama T, et al. Transfection of glutathione S-transferase (GST)-pi antisense complementary DNA
increases the sensitivity of a colon cancer cell line to adriamycin, cisplatin, melphalan, and etoposide. Cancer Res. 1996;56:3577-3582.
43. Stoehlmacher J, Park DJ, Zhang W, et al. Association between
glutathione S-transferases P1, T1 and M1 genetic polymorphism and
survival of patients with metastatic colorectal cancer. J Natl Cancer
Inst. 2002;94:936-942.
44. Watson MA, Stewart RK, Smith GB, et al. Human glutathione
S-transferase P1 polymorphisms. Carcinogenesis. 1998;19:275-280.
45. Vandier D, Calvez V, Massade L, et al. Transactivation of metallothionein promoter in cisplatin-resistant cancer cells: a specific
gene therapy strategy. J Natl Cancer Inst. 2000;92:642-647.
46. Husain A, He G,Venkatraman ES, et al. BCRA1 up-regulation is
associated with repair-mediated resistance to cis-diamminedichloroplatinum (II). Cancer Res. 1998;58:1120-1123.
47. Scully R, Livingston DM. In search of the tumor-suppressor
functions of BRCA1 and BCRA2. Nature. 2000;408:429-432.
July/August 2003, Vol. 10, No.4
48. Kakolyris S, Giatromanolaki A, Koukourakis M, et al. Nuclear
localization of human AP endonuclease 1 (HAP1/Ref-1) associates
with prognosis in early operable non-small-cell lung cancer (NSCLC).
J Pathol. 1999;189:351-357.
49. Bobola MS, Blank A, Berger MS, et al. Apurinic/apyrimidinic
endonuclease activity is elevated in human adult gliomas. Clin Cancer Res. 2001;7:3510-3518.
Cancer Control 305
Human Molecular Genetics, 2004, Vol. 13, No. 20
doi:10.1093/hmg/ddh260
Advance Access published on August 18, 2004
2443–2449
BRCA1 mRNA expression levels as an indicator
of chemoresistance in lung cancer
Miquel Taron1, Rafael Rosell1,*, Enriqueta Felip2, Pedro Mendez1, John Souglakos5,
Maria Sanchez Ronco6, Cristina Queralt1, Joaquim Majo3, Jose Miguel Sanchez1,
Jose Javier Sanchez6 and Jose Maestre4
1
Medical Oncology Service, Institut Catala d’Oncologia, Hospital Germans Trias i Pujol, Badalona, Barcelona, Spain,
Medical Oncology Service, 3Pathology Department and 4Department of Thoracic Surgery, Hospital Vall d’Hebron,
Barcelona, Spain, 5Department of Medical Oncology, General Hospital of Heraklion, Crete, Greece and 6Autonomous
University of Madrid, Madrid, Spain
2
Received April 27, 2004; Revised July 15, 2004; Accepted August 4, 2004
Lung cancer is the most common cancer, with dismal outcome. Treatment approaches, including cisplatinbased chemotherapy and surgery, are currently based on the clinical classification of the tumor, without
genetic assessment for predicting differential chemosensitivity. BRCA1 plays a central role in DNA repair,
and decreased BRCA1 mRNA expression in the human breast cancer HCC1937 cell line caused cisplatin
hypersensitivity, but the relation between BRCA1 and survival in lung cancer patients has never been examined.
We used real-time quantitative polymerase chain reaction to determine BRCA1 mRNA levels in 55 surgically
resected tumors of non-small-cell lung cancer patients who had received neoadjuvant gemcitabine/cisplatin
chemotherapy, and divided the gene expression values into quartiles. When results were correlated with outcome, two cut-offs were observed; patients with levels <0.61 had better outcome, and those >2.45 had poorer
outcome. Median survival was not reached for the 15 patients in the bottom quartile, whereas for the 28 in the
two middle quartiles, it was 37.8 months (95% CI, 10.6 – 65), and for the 12 patients in the top quartile, it was
12.7 months (95% CI, 0.28 – 28.8) (P 5 0.01). Moreover, when patients were stratified by pathologic stage,
those in the bottom quartile had a decreased risk of death (HR 5 0.206; 95% CI, 0.05 – 0.83; P 5 0.026) compared with those in the top quartile, and those in the two middle quartiles also had a decreased risk of
death (HR 5 0.294; 95% CI, 0.10 – 0.83; P 5 0.020) compared with those in the top quartile. BRCA1 expression
is potentially an important tool for use in cancer management and should be assessed for predicting differential chemosensitivity and tailoring chemotherapy in lung cancer.
INTRODUCTION
Breast cancer 1 (BRCA1) plays a crucial role in DNA repair,
and decreased BRCA1 mRNA expression has been observed
in both sporadic and hereditary breast cancers (1); however,
its potential effect in lung cancer has never been examined.
BRCA1 is implicated in transcription-coupled nucleotide excision repair (TC-NER), and modulation of its expression leads
to modification of TC-NER and hence to radio- and chemoresistance. Upregulation of BRCA1 expression led to increased
cisplatin resistance in the SKOV-3 human ovarian cancer
cell line (2), and restoration of BRCA1 in the BRCA1negative HCC1937 human breast cancer cell line restored
radioresistance (3). BRCA1 is also involved in homologous
recombination repair (HRR) and non-homologous end
joining, in response to DNA damage (4). In addition, it is a
component of a large DNA repair complex termed the
BRCA1-associated genome surveillance complex, which contains a number of mismatch repair proteins, indicating a potential role for BRCA1 in mismatch repair (1,4). BRCA1 may also
be a regulator of mitotic spindle assembly, as BRCA1 and
b-tubulin colocalize to the microtubules of the mitotic
spindle and to the centrosomes (5). Finally, enhanced
BRCA1 expression has been linked to apoptosis through the
c-Jun N-terminal kinase pathway (6), which is activated by
cisplatin-induced DNA damage; inhibition of this pathway
*To whom correspondence should be addressed at: Medical Oncology Service, Catalan Institute of Oncology, Hospital Germans Trias i Pujol, Ctra
Canyet, s/n, 08916 Badalona, Barcelona, Spain. Tel: þ34 934978925; Fax: þ34 934978950; Email: rrosell@ns.hugtip.scs.es
Human Molecular Genetics, Vol. 13, No. 20 # Oxford University Press 2004; all rights reserved
2444
Human Molecular Genetics, 2004, Vol. 13, No. 20
increased cisplatin sensitivity in cell lines (7). Decreased
BRCA1 mRNA expression in a breast cancer cell line, as
determined by real-time quantitative polymerase chain reaction (RT-QPCR), led to greater sensitivity to cisplatin and
etoposide, but to greater resistance to the microtubule-interfering agents paclitaxel and vincristine (8). Recently, furthermore,
reconstitution of wild-type BRCA1 into the BRCA1-negative
HCC1937 breast cancer cell line (9) resulted in a 20-fold
increase in cisplatin resistance and, in contrast, in a 1000 –
10 000-fold increase in sensitivity to antimicrotubule drugs
(paclitaxel and vinorelbine) (4,10). Mouse models carrying
conditional disruption of BRCA1 were highly sensitive to
doxorubicin and gamma irradiation but resistant to tamoxifen,
providing additional evidence for differential chemosensitivity
linked to BRCA1 expression (11). When BRCA1 expression
was examined by semi-quantitative PCR in women with
sporadic breast cancer, low BRCA1 mRNA levels (bottom
quartile) were associated with a higher frequency of distant
metastases (12).
Despite the wealth of data in cell lines and mouse models,
only one small study has examined the correlation of BRCA1
and BRCA2 mRNA expression with response to chemotherapy
in the clinical setting. Among 25 women with docetaxel-treated
locally advanced or metastatic breast cancer (13), only BRCA2
mRNA levels were significantly lower in responders than in
non-responders, though a slight difference was also observed
for BRCA1. Non-small-cell lung cancer (NSCLC) accounts
for 80% of all lung cancers, with 1.2 million new cases worldwide each year. NSCLC resulted in more than 1 million deaths
worldwide in 2001, and is the leading cause of cancer-related
mortality in both men and women (31 and 25%, respectively)
(14). The overall 5-year survival of patients with NSCLC has
remained at ,15% for the past 20 years. Stage grouping of
TNM subsets (T, primary tumor; N, regional lymph nodes; M,
distant metastases) permits the identification of patient groups
with similar prognosis and treatment options. Five-year survival is around 25% for pathologic stage IIB (T1-2N1M0,
T3N0M0), 13% for stage IIIA (T3N1M0, T1-2-3N2M0) and
a low 7% for stage IIIB (T4N0-1-2M0) (15). Small randomized
studies of cisplatin-based chemotherapy followed by surgery in
clinical stage IIIA (16) or stage IIB –IIIB (17) showed remarkable improvement in survival over patients treated either with
surgery alone or with surgery followed by radiotherapy.
Event-free survival was similar in the two studies (12.7 (16)
and 20 (17) months in the neoadjuvant chemotherapy arm
and 5.8 (16) and 5 (17) months in the surgery arm). In
general, neoadjuvant chemotherapy induces tumor shrinkage
and sterilizes metastatic lymph nodes, leading to pathologic
downstaging in 33% and complete pathologic remission in
up to 14% of patients (18). Although a wealth of data indicates
that changes in the level of several gene transcripts can modulate differential chemosensitivity between patients with the
same TNM subset, at present no predictive genetic markers
of chemotherapy response are used for tailoring treatment.
On the basis of the evidence for the role of BRCA1 in breast
and ovarian cancers, we reasoned that BRCA1 mRNA
expression could also play an important role in predicting
differential chemotherapy sensitivity in NSCLC. We examined the potential predictive value of BRCA1 mRNA
expression in resected specimens from stage IIB, IIIA and
IIIB NSCLC patients treated with neoadjuvant gemcitabine/
cisplatin followed by surgery.
RESULTS
Median survival was 37.8 months (95% CI, 27 – 48.5 months)
for all patients, 51.9 months (95% CI, 31.6 –72.4 months) for
patients who underwent lobectomy and 25.8 months (95%
CI, 12.7– 38.8 months) for those who underwent pneumonectomy. BRCA1 was detected in all tumors, although there
was considerable variation in its level of expression, with
values relative to the b-actin internal control ranging 37fold, from 0.28 to 10.43. Amplification plots obtained for
the genes BRCA1 and b-actin are shown in Figure 1. Values
ranged from 0.28 to 0.61 [interpatient coefficient of variation
(ICV), 30.7%] for the 15 patients in the bottom quartile,
from 0.65 to 1.20 (ICV, 17.4%) for the 14 patients in the
second quartile, from 1.23 to 2.37 (ICV, 17.7%) for the 14
patients in the third quartile, and from 2.45 to 10.43 (ICV,
54.7%) for the 12 patients in the top quartile. Owing to the
similar values and ICVs observed in the second and third quartiles, these two groups were merged for statistical analyses.
No differences in clinical characteristics were observed
according to quartiles of BRCA1 mRNA expression levels
(Table 1). However, for patients in the bottom quartile, radiographic response tended to be higher than for those in the
middle or top quartiles (66.7, 57.1 and 58.3%, respectively),
complete resection was attained more often (93.3, 78.6 and
83.3%, respectively), and a lobectomy was performed more
often [73.3, 32.1 (P ¼ 0.005) and 58.3% (P ¼ 0.2), respectively] (Table 1). Median survival was not reached for the 15
patients in the bottom quartile, whereas for the 28 patients
in the two middle quartiles, it was 37.8 months (95% CI,
10.6 – 65), and for the 12 patients in the top quartile, it was
12.7 months (95% CI, 0.28– 28.8) (P ¼ 0.01) (Fig. 2). Five
patients who attained a complete pathologic response
(T0N0) were all in the bottom quartile of BRCA1 levels
(Table 2). Conversely, in the majority of patients with high
BRCA1 levels, no clinical or pathologic downstaging was
observed following chemotherapy and surgery (Table 3).
When patients were stratified by pathologic stage, those in
the bottom quartile had a decreased risk of death
(HR ¼ 0.206; 95% CI, 0.05 –0.83; P ¼ 0.026) compared
with those in the top quartile, and those in the two middle
quartiles also had a decreased risk of death (HR ¼ 0.294;
95% CI, 0.10 – 0.83; P ¼ 0.020) compared with those in the
top quartile. When patients were stratified by clinical stage,
a similar pattern was observed. Those in the bottom quartile
had a decreased risk of death (HR ¼ 0.220; 95% CI, 0.06 –
0.77; P ¼ 0.018) compared with those in the top quartile,
and those in the two middle quartiles also had a decreased
risk of death (HR ¼ 0.430; 95% CI, 0.17 – 1.1; P ¼ 0.078)
compared with those in the top quartile.
DISCUSSION
Resistance to cytotoxic drugs is the major impediment to the
successful treatment of many tumor types, especially in lung
cancer. The elucidation of the mechanisms of this resistance
Human Molecular Genetics, 2004, Vol. 13, No. 20
2445
Figure 1. Example of the amplification plots (DRn versus cycle number) of (A) b-actin and (B) BRCA1 cDNAs. Both figures correspond to serial dilutions of
cDNA obtained from one of the samples. (C) and (D) Examples of the validation curves for relative quantification. Different primers and probe concentrations
were assayed for b-actin and BRCA1 gene expression analysis to obtain the optimal PCR efficiency. In order for the relative quantification to be valid, the amplification efficiency of the target (BRCA1 ) and the reference (b-actin ) amplification must be approximately equal. A sensitive method for assessing whether two
amplicons have the same amplification efficiency is to see how DCt varies when using a serial dilution of a control cDNA. We performed two validations: one
using control cDNA, another using cDNA from paraffin-embedded samples. (C) Several runs with serial dilutions were performed to confirm that the slope ,0.1
in the plot DCt value versus log10 input amount cDNA, defined as Ct BRCA1 in each dilution minus Ct b-actin in the same dilution. (D) For primers and probe
sets, the slope of the plot Ct versus log10 input amount cDNA needed to be between 23.25 and 23.45, since a slope of 23.33 represents 100% efficiency. The
slopes in our assays were 23.36 for b-actin and 23.32 for BRCA1, with a correlation coefficient (R 2) .0.98.
is crucial for improving treatment outcome and for selecting
and customizing chemotherapy. Upregulation of DNA repair
genes has been related to resistance to cisplatin and radiotherapy. The repair of cisplatin DNA damage occurs via
the activity of the nucleotide excision repair endonuclease
(ERCC1/XPF) and Rad51-related HRR proteins (19,20). We
had previously used RT-QPCR to assess mRNA levels of
ERCC1 and RRM1, genes related to global genome NER but
not directly to TC-NER (20), and found that overexpression
of either of these genes influenced survival in gemcitabine/cisplatin-treated stage IV NSCLC patients (21 – 23). However,
unlike ERCC1, BRCA1 is involved in TC-NER (3,24), and
may thus be a better predictive marker of cisplatin response.
The availability of fresh tumor tissue in the clinical setting
is not yet common, and the recovery of mRNA from paraffinembedded tissue has therefore become very important. mRNA
real-time assays permit quantitative and accurate measurement
of gene expression (25). In the present study, we used RTQPCR to quantitatively analyze BRCA1 mRNA expression
in processed formalin-fixed, paraffin-embedded tissues from
resected lung cancer patients and demonstrated that BRCA1
expression can be accurately assessed. BRCA1 gene
expression was detectable in all 55 samples analyzed in this
study. Patients in the bottom quartile of BRCA1 mRNA
levels (,0.61) obtained the maximum benefit of neoadjuvant
gemcitabine/cisplatin chemotherapy, whereas those in the top
quartile (.2.45) had the poorest outcome. These findings
support the hypothesis that BRCA1 mRNA expression levels
could be an indicator of differential cisplatin sensitivity in
NSCLC, which is consistent with findings in pre-clinical
models in breast cancer (2 – 4,8,10,11). The HCC1937 cell
line (9), from a primary breast carcinoma with a germline
BRCA1 mutation, was transfected with either wild-type
BRCA1 or an empty vector to test response to antimicrotubule
drugs (paclitaxel and vinorelbine) and DNA-damaging drugs
(cisplatin, bleomycin and etoposide). Reconstitution of wildtype BRCA1 function into HCC1937 resulted in a 1000-fold
increase in sensitivity to paclitaxel and a 10 000-fold increase
in sensitivity to vinorelbine. Conversely, it resulted in a 2-fold
increase in resistance to bleomycin, a 20-fold increase in
2446
Human Molecular Genetics, 2004, Vol. 13, No. 20
Table 1. Patient characteristics according to BRCA1 mRNA expression levels (bottom quartile versus two middle quartiles versus top quartile)
Sex
Female
Male
Age
Median, range
Histology
Squamous cell carcinoma
Adenocarcinoma
Large cell carcinoma
Initial staging
IIB
T3N0
IIIA
T3N1
T1N2
T2N2
T3N2
IIIB
T4N0
T4N1
T4N2
Chemotherapy regimen
Gemcitabine/cisplatin
Gemcitabine/carboplatin
Radiographic response
Partial response
Stable disease
Progressive disease
Surgical results
Complete resection
Incomplete resection
Unresectable
Surgical procedures
Lobectomy
Pneumonectomy
Bilobectomy
Unresectable
Bottom quartile of BRCA1
levels (0.28–0.61) N
Middle quartiles of BRCA1
levels (0.65– 2.37) N
Top quartile of BRCA1
levels (2.45–10.43) N
3 (20%)
12 (80%)
3 (10.7%)
25 (89.3%)
0
12 (100%)
60 (49–74%)
65 (51–76%)
61 (45–71%)
5 (33.3%)
7 (46.7%)
3 (20%)
16 (57.1%)
11 (39.3%)
1 (3.6%)
5 (41.7%)
2 (16.7%)
5 (41.7%)
2 (13.3%)
3 (10.7%)
1 (8.3%)
0
0
1 (6.7%)
3 (20%)
1 (3.6%)
0
6 (21.4%)
7 (25%)
3 (25%)
0
1 (8.3%)
2 (16.7%)
6 (40%)
1 (6.7%)
2 (13.3%)
8 (28.6%)
2 (7.1%)
1 (3.6%)
3 (25%)
1 (8.3%)
1 (8.3%)
15 (100%)
0
26 (92.9%)
2 (7.1%)
10 (83.3%)
2 (16.7%)
10 (66.7%)
5 (33.3%)
0
16 (57.1%)
10 (35.7%)
2 (7.1%)
7 (58.3%)
4 (33.3%)
1 (8.3%)
14 (93.3%)
1 (6.7%)
0
22 (78.6%)
5 (17.9%)
1 (3.6%)
10 (83.3%)
2 (16.7%)
0
11 (73.3%)
4 (26.7%)
0
0
9 (32.1%)
14 (50%)
4 (14.3%)
1 (3.6%)
7 (58.3%)
5 (41.7%)
0
0
resistance to cisplatin and a .100-fold increase in resistance
to etoposide (10). Interestingly, BRCA1 failed to modulate
resistance or sensitivity to the antimetabolite 5-fluorouracil,
perhaps reflecting the distinct mode of action of antimetabolites (10).
BRCA1 mRNA is reduced in sporadic breast cancer cells
despite a lack of mutations. Aberrant cytosine methylation
of the BRCA1 CpG island promoter may be a partial mechanism of BRCA1 repression in sporadic breast cancer (26,27).
Along the same lines, it has been shown that the Fanconi
anemia (FANC)-BRCA pathway (28) regulates cisplatin sensitivity, with the clinical finding that methylation of FANCF
confers increased cisplatin sensitivity in ovarian cancer (29).
FANC genes interact with those involved in DNA repair pathways, including BRCA1, Rad-51, ATM and NBS1 (28).
Cigarette smoking remains the principal cause of lung
cancer, with 85– 90% of all lung cancer patients having
smoked cigarettes at some time. The profound role of cigarette
smoking in lung cancer development and DNA damage could
also contribute to the dismal outcome and the limited effect of
chemotherapy as DNA repair capacity is stimulated in
response to DNA damage caused by tobacco carcinogens.
Among heavy smokers, both lung cancer patients and controls
have more proficient DNA repair capacity (measured by hostcell reactivation assay) in lymphocytes than non- or light
smokers (30). Elevated DNA repair capacity has been associated with cisplatin resistance both in NSCLC cell lines (31)
and in lung cancer patients (32). The expression levels of
DNA repair genes, including BRCA1, can be expected to be
elevated in lung cancer patients, particularly those who are
heavy smokers.
Several cisplatin-based doublets demonstrated similar survival in a randomized study of more than 1000 metastatic
NSCLC patients (33); furthermore, other studies have found
no survival differences between cisplatin alone and cisplatin/
paclitaxel (34), or between docetaxel alone and docetaxel/
cisplatin (35). On the basis of our results and of pre-clinical
data (10), we can speculate that patients with low BRCA1
mRNA levels can benefit from single-agent cisplatin,
whereas those with high levels would benefit from singleagent docetaxel or paclitaxel. In contrast, high BRCA1 levels
may diminish the synergism between taxanes and cisplatin
or carboplatin. Although sensitivity to antimetabolites, such
as gemcitabine, may not be affected by BRCA1 levels,
Human Molecular Genetics, 2004, Vol. 13, No. 20
2447
Figure 2. Median survival according to quartiles of BRCA1 mRNA expression levels. Median survival was not reached for those in the bottom quartile, whereas
it was 37.8 months for those in the middle quartiles, and 12.7 months for those in the top quartile.
Table 2. BRCA1 mRNA levels and clinical stage in patients who attained complete pathologic response after neoadjuvant chemotherapy followed by surgery
Patient
BRCA1 mRNA levels
Pre-treatment clinical stage
Post-treatment clinical stage
Pathologic stage
1
2
3
4
5
0.31
0.28
0.30
0.33
0.34
T3N2
T2N2
T4N2
T4N2
T4N1
T2N0
T1N0
T2N1
T2N0
T4N1
T0N0
T0N0
T0N0
T0N0
T0N0
gemcitabine/cisplatin synergism may be partially abrogated in
tumors with high BRCA1 mRNA levels; on the other hand,
these tumors may benefit from the synergism observed
between taxanes and gemcitabine. To date, no other clinical
study has assessed BRCA1 mRNA expression as a predictive
marker of chemotherapy response in lung cancer. If further
research validates our findings, BRCA1 mRNA assessment
will provide an important tool for customizing NSCLC chemotherapy in order to improve survival in this very common and
fatal disease.
MATERIALS AND METHODS
Patients
In all patients, neoadjuvant chemotherapy was indicated after
evaluation by a thoracic surgeon, a radiologist, a medical
oncologist and a radiation oncologist. Patients received three
cycles of neoadjuvant chemotherapy; 51 received cisplatin
100 mg/m2 day 1 plus gemcitabine 1250 mg/m2 days 1 and
8 every 21 days, and four received carboplatin AUC ¼ 5
day 1 plus gemcitabine 1000 mg/m2 days 1 and 8 every 21
days. A thoracotomy was performed within 4– 5 weeks after
the last chemotherapy cycle; the surgical procedure was
based on the extent of tumor at the time of the initial
presentation.
BRCA1 gene expression analysis by RT-QPCR
We examined BRCA1 gene expression in formalin-fixed,
paraffin-embedded surgical resected specimens from the
55 patients as previously described (36,37). After standard
tissue sample deparaffinization using xylene and alcohols,
samples were lyzed in a Tris – chloride, EDTA, sodium
dodecyl sulfate (SDS) and proteinase K containing buffer.
RNA was then extracted with phenol – chloroform– isoamyl
alcohol followed by precipitation with isopropanol in the presence of glycogen and sodium acetate. RNA was resuspended
in RNA storage solution (Ambion Inc., Austin TX, USA) and
treated with DNase I to avoid DNA contamination. cDNA was
synthesized using M-MLV retrotranscriptase enzyme. Template cDNA was added to TaqMan Universal Master Mix
(AB; Applied Biosystems, Foster City, CA, USA) in a
12.5ml reaction with specific primers and probe for each
gene. The primer and probe sets were designed using Primer
Express 2.0 Software (AB). Quantification of gene expression
was performed using the ABI Prism 7900HT Sequence Detection System (AB). Primers and probe for BRCA1 mRNA
expression analysis were designed according to the Ref
Seq NM_007294 (http://www.ncbi.nlm.nih.gov/LocusLink).
Forward primer is located in exon 8 (position 4292 –
4317 bp), reverse primer in exon 9 (position 4336 – 4360 bp)
and probe in the exon 8/9 junction (position 4313 bp –
4333 bp). The PCR product size generated with these
2448
Human Molecular Genetics, 2004, Vol. 13, No. 20
Table 3. Correlation of clinical and pathologic stage in patients in the top
quartile of BRCA1 mRNA expression
Patient
mRNA BRCA1
levels
Pre-treatment
clinical stage
Post-treatment
clinical stage
Pathologic
stage
1
2
3
4
5
6
7
8
9
10
11
12
2.8
5.5
10.43
2.45
4.12
6.93
2.81
3.09
5.61
3.36
2.8
2.62
T3N2
T2N2
T3N1
T3N0
T4N0
T4N2
T4N1
T3N1
T3N1
T3N2
T4N0
T4N0
T3N2
—a
T2N0
T3N0
T1N0
T3N0
T4N1
T2N0
T2N0
T3N2
T3N0
T4N0
T2N2
T2N0
T2N0
T3N0
T4N0
T2N0
T3N1
T2N0
T2N0
T2N2
T3N0
T2N0
a
Data not available.
primers was 69 bp. The primers and 50 labeled fluorescent
reporter dye (6FAM) probe were as follows: b-actin:
forward 50 -TGA GCG CGG CTA CAG CTT-30 , reverse
50 -TCC TTA ATG TCA CGC ACG ATT T-30 , probe
50 -ACC ACC ACG GCC GAG CGG-30 ; BRCA1: forward
50 -GGC TAT CCT CTC AGA GTG ACA TTT TA-30 ,
reverse 50 -GCT TTA TCA GGT TAT GTT GCA TGG T-30 ,
probe 50 -CCA CTC AGC AGA GGG-30 .
Relative gene expression quantification was calculated
according to the comparative Ct method using b-actin as an
endogenous control and commercial RNA controls (Stratagene, La Jolla, CA) as calibrators. Final results, were determined as follows: 22(DCt sample 2 DCt calibrator), where DCt
values of the calibrator and sample are determined by subtracting the Ct value of the target gene from the value of the bactin gene. In all experiments, only triplicates with a SD of
the Ct value ,0.20 were accepted. In addition, for each
sample analyzed, a retrotranscriptase minus control was run
in the same plate to assure lack of genomic DNA contamination (Fig. 1).
Statistical methods
In order to provide an easily interpretable evaluation of the
effect of BRCA1 mRNA expression, gene expression values
were divided into quartiles. ICVs were calculated to assess
similarities between quartiles. Hazard ratios were calculated
with the univariate Cox model, stratifying by pathologic and
clinical stage, and comparison between Kaplan – Meier survival curves was performed with the log-rank test. All tests of
statistical significance were two-sided, with a statistical
power of 80%, and significance was set at 0.05 except in multiple comparisons, where it was set at 0.017 in accordance
with the Bonferroni correction.
ACKNOWLEDGEMENTS
The authors thank Renée O’Brate for assistance with the
manuscript. This study was supported by Spanish Ministry
of Health research grants provided through Red Temática de
Investigación Cooperativa de Centros de Cáncer (CO-010)
and through Ayuda Carlos III (RCESP 03/09) and by
funding from La Fundació Badalona Contra El Càncer.
REFERENCES
1. Kennedy, R.D., Quinn, J.E., Johnston, P.G. and Harkin, D.P. (2002)
BRCA1: mechanisms of inactivation and implications for management of
patients. Lancet, 360, 1007–1014.
2. Husain, A., He, G., Venkatraman, E.S. and Spriggs, D.R. (1998) BRCA1
up-regulation is associated with repair-mediated resistance to cisdiamminedichloroplatinum(II). Cancer Res., 58, 1120–1123.
3. Abbott, D.W., Thompson, M.E., Robinson-Benion, C., Tomlinson, G.,
Jensen, R.A. and Holt, J.T. (1999) BRCA1 expression restores radiation
resistance in BRCA1-defective cancer cells through enhancement of
transcription-coupled DNA repair. J. Biol. Chem., 274, 18808–18812.
4. Mullan, P.B., Quinn, J.E., Gilmore, P.M., McWilliams, S., Andrews, H.,
Gervin, C., McCabe, N., McKenna, S., White, P., Song, Y.H. et al. (2001)
BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to
antimicrotubule agents. Oncogene, 20, 6123–6131.
5. Lotti, L.V., Ottini, L., D’Amico, C., Gradini, R., Cama, A., Belleudi, F.,
Frati, L., Torrisi, M.R. and Mariani-Costantini, R. (2002) Subcellular
localization of the BRCA1 gene product in mitotic cells. Genes,
Chromosomes Cancer, 35, 193–203.
6. Harkin, D.P., Bean, J.M., Miklos, D., Song, Y.H., Truong, V.B.,
Englert, C., Christians, F.C., Ellisen, L.W., Maheswaran, S., Oliner, J.D.
et al. (1999) Induction of GADD45 and JNK/SAPK-dependent apoptosis
following inducible expression of BRCA1. Cell, 97, 575 –586.
7. Potapova, O., Haghighi, A., Bost, F., Liu, C., Birrer, M.J., Gjerset, R. and
Mercola, D. (1997) The Jun kinase/stress-activated protein kinase
pathway functions to regulate DNA repair and inhibition of the pathway
sensitizes tumor cells to cisplatin. J. Biol. Chem., 272, 14041– 14044.
8. Lafarge, S., Sylvain, V., Ferrara, M. and Bignon, Y.J. (2001)Inhibition of
BRCA1 leads to increased chemoresistance to microtubule-interfering
agents, an effect that involves the JNK pathway. Oncogene, 20,
6597–6606.
9. Tomlinson, G.E., Chen, T.T.L., Stastny, V.A., Virmani, A.K.,
Spillman, M.A., Tonk, V., Blum, J.L., Schneider, N.R., Wistuba, I.I.,
Shay, J.W. et al. (1998) Characterization of a breast cancer cell line
derived from a germ-line BRCA1 mutation carrier. Cancer Res., 58,
3237–3242.
10. Quinn, J.E., Kennedy, R.D., Mullan, P.B., Gilmore, P.M., Carty, M.,
Johnston, P.G. and Harkin, D.P. (2003) BRCA1 functions as a differential
modulator of chemotherapy-induced apoptosis. Cancer Res., 63,
6221–6228.
11. Brodie, S.G., Xu, X., Qiao, W., Li, W.M., Cao, L. and Deng, C.X. (2001)
Multiple genetic changes are associated with mammary tumorigenesis in
Brca1 conditional knockout mice. Oncogene, 20, 7514–7523.
12. Seery, L.T., Knowlden, J.M., Gee, J.M.W., Robertson, J.F.R., Kenny, F.S.,
Ellis, I.O. and Nicholson, R.I. (1999) BRCA1 expression levels predict
distant metastasis of sporadic breast cancers. Int. J. Cancer (Pred. Oncol.),
84, 258 –262.
13. Egawa, C., Miyoshi, Y., Takamura, Y., Taguchi, T., Tamaki, Y. and
Noguchi, S. (2001) Decreased expression of BRCA2 mRNA predicts
favorable response to docetaxel in breast cancer. Int. J. Cancer (Pred.
Oncol.), 95, 255–259.
14. Jemal, A., Murray, T., Samuels, A., Ghafoor, A., Ward, E. and Thun, M.J.
(2004) Cancer statistics, 2003. CA Cancer J. Clin., 54, 8 –29.
15. Mountain, C.F. (1997) Revisions in the international system for staging
lung cancer. Chest, 111, 1710–1717.
16. Pass, H.I., Pogrebniak, H.W., Steinberg, S.M., Mulshine, J. and Minna, J.
(1992) Randomized trial of neoadjuvant therapy for lung cancer: interim
analysis. Ann. Thor. Surg., 53, 992 –998.
17. Rosell, R., Gómez-Codina, J., Camps, C., Maestre, J., Padilla, J., Cantó, A,
Mate, J.L., Li Shanrong, Roig J., Olazábal, A. et al. (1994) A randomized
trial comparing preoperative chemotherapy plus surgery with surgery alone
in patients with non-small-cell lung cancer. N. Engl. J. Med., 330, 153–158.
18. Martini, N., Kris, M.G., Flehinger, B.J., Gralla, R.J., Bains, M.S., Burt, M.E.,
Heelan, R., McCormack, P.M., Pisters, K.M.W., Rigas, J.R. et al. (1993)
Preoperative chemotherapy for stage IIIa (N2) lung cancer: The SloanKettering experience with 136 patients. Ann. Thorac. Surg., 55, 1365–1374.
Human Molecular Genetics, 2004, Vol. 13, No. 20
19. Aloyz, R., Xu, Z.Y., Bello, V., Bergeon, J., Han, F.Y., Yan, Y.,
Malapetsa, A., Alaoui-Jamali, M.A., Duncan, A.M.V. and Panasci, L.
(2002) Regulation of cisplatin resistance and homologous recombinational
repair by the TFIIH subunit XPD. Cancer Res., 62, 5457–5462.
20. Furuta, T., Ueda, T., Aune, G., Sarasin, A., Kraemer, K.H. and Pommier,
Y. (2002) Transcription-coupled nucleotide excision repair as a
determinant of cisplatin sensitivity of human cells. Cancer Res., 62,
4899–4902.
21. Lord, R.V.N., Brabender, J., Gandara, D., Alberola, V., Camps, C.,
Domine, M., Cardenal, F., Sanchez, J.M., Gumerlock, P.H., Taron, M.
et al. (2002) Low ERCC1 expression correlates with prolonged survival
after cisplatin plus gemcitabine chemotherapy in non-small-cell lung
cancer. Clin. Cancer Res., 8, 2286–2291.
22. Rosell, R., Scagliotti, G., Danenberg, K.D., Lord, R., Bepler, G.,
Novello, S., Cooc, J., Crino, L., Sancehz, J.J., Taron, M. et al. (2003)
Transcripts in pretreatment biopsies from a three-arm randomized
trial in metastatic non-small-cell lung cancer. Oncogene, 22,
3548–3553.
23. Rosell, R., Danenberg, K.D., Alberola, V., Bepler, G., Sanchez, J.J.,
Camps, C., Provencio, M., Isla, D., Taron, M., Diz, P. et al. (2004)
Ribonucleotide reductase mRNA expression and survival in gemcitabine/
cisplatin-treated advanced non-small-cell lung cancer patients. Clin.
Cancer Res., 10, 1318–1325.
24. LePage, F., Randrianarison, V., Marot, D., Cabannes, J., Perricaudet, M.,
Feunteun, J. and Sarasin, A. (2000) BRCA1 and BRCA2 are necessary for
the transcription-coupled repair of the oxidative 8-oxoguanine lesion in
human cells. Cancer Res., 60, 5548–5552.
25. Einspahr, J.G., Krouse, R.S., Yochim, J.M., Danenberg, P.V.,
Danenberg, K.D., Bhattacharyya, A.K., Martinez, M.E. and Alberts, D.S.
(2003) Association between cyclooxygenase expression and colorectal
adenoma characteristics. Cancer Res., 63, 3891–3893.
26. Rice, J.C., Massey-Brown, K.S. and Futscher, B.W. (1998) Aberrant
methylation of the BRCA1CpG island promoter is associated with
decreased BRCA1 mRNA in sporadic breast cancer cells. Oncogene, 17,
1807–1812.
27. Esteller, M., Silva, J.M., Domı́nguez, G., Bonilla, F., Matias-Guiu, X.,
Lerma, E., Bussaglia, Prat, J., Harkes, I.C., Repasky, E.A. et al. (2000)
Promoter hypermethylation and BRCA1 inactivation in sporadic breast
and ovarian tumors. J. Natl Cancer Inst., 92, 564– 569.
2449
28. Hussain, S., Uit E, Huber, P.A.J., Medhurst, A.L., Ashworth, A. and
Mathew, C.G. (2003). Direct interaction of the Fanconi with BRCA2/
FANCD1. Hum. Mol. Genet., 12, 2503–2510
29. Taniguchi, T., Tischkowitz, M., Ameziane, N., Hodgson, S.V.,
Mathew, C.G., Joenje, H., Mok, S.C and D’Andrea, A.D. (2003)
Disruption of the Fanconi anemia–BRCA pathway in cisplatin-sensitive
ovarian tumors. Nat. Med., 9, 568–574.
30. Wei, Q., Cheng, L., Amos, C.I., Wang, L.E., Guo, Z., Hong, W.K.H and
Spitz, M.R. (2000). Repair of tobacco carcinogen-induced DNA adducts
and lung cancer risk: a molecular epidemiologic study. J. Natl Cancer
Inst., 92, 1764–1772.
31. Zeng-Rong, N., Paterson, J., Alpert, L., Tsao, M.S., Viallet, J. and
Alaoui-Jamali, M.A. (1995) Elevated DNA repair capacity is associated
with intrinsic resistance of lung cancer to chemotherapy. Cancer Res.,
55, 4760–4764.
32. Bosken, C.H., Wei, Q., Amos, C.I. and Spitz, M.R. (2002) An analysis of
DNA repair as a determinant of survival in patients with non-small-cell
lung cancer. J. Natl Cancer Inst., 94, 1091–1099.
33. Schiller, J.H., Harrington, D., Velan, C.P., Langer, C., Sandler, A.,
Krrok, J., Zhu, J. and Johnson, D.H. (2002) Comparison of tour
chemotherapy regimens for advanced non-small-cell lung cancer.
N. Engl. J. Med., 346, 92–98.
34. Gatzemeier, U., von Pawel, J., Gottfried, M., ten Velde, G.P.M.,
Mattson, K., DeMarinis, F., Harper, P., Salvati, F., Robinet, G., Lucenti, A.
et al. (2000) Phase III comparative study of high-dose cisplatin versus a
combination of paclitaxel and cisplatin in patients with advanced nonsmall-cell lung cancer. J. Clin. Oncol., 18, 3390–3399.
35. Georgoulias, V., Ardavanis, A., Agelidou, A., Agelidou, M.,
Chandrinos, V., Tsaroucha, E., Toumbis, M., Kouroussis, C., Syrigos, K.,
Polyzos, A. et al. (2004) Docetaxel versus docetaxel plus cisplatin as
front-line treatment of patients with advanced non-small-cell lung cancer:
A randomized, multicenter phase III trial. J. Clin. Oncol., 22, 2602–2609.
36. Specht, K., Richter, T., Müller, U., Walch, A., Werner, M. and Hofler, H.
(2001) Quantitative gene expression analysis in microdissected archival
formalin-fixed and paraffin-embedded tumor tissue. Am. J. Pathol., 158,
419–429.
37. Krafft, A.E., Duncan, B.W., Bijwaard, K.E., Taubenberger, J.K. and
Lichy, J.H. (1997) Optimization of the isolation and amplification of RNA
from formalin fixed, paraffin-embedded tissue: The Armed Forces Institute
of Pathology experience and literature review. Mol. Diagn., 3, 217–230.
2286 Vol. 8, 2286 –2291, July 2002
Clinical Cancer Research
Low ERCC1 Expression Correlates with Prolonged Survival after
Cisplatin plus Gemcitabine Chemotherapy in Non-Small Cell
Lung Cancer1
Reginald V. N. Lord,2 Jan Brabender,2
David Gandara, Vicente Alberola, Carlos Camps,
Manuel Domine, Felip Cardenal,
José M. Sánchez, Paul H. Gumerlock,
Miquel Tarón, José J. Sánchez,
Kathleen D. Danenberg, Peter V. Danenberg, and
Rafael Rosell3
University of Southern California/Norris Comprehensive Cancer
Center, Los Angeles, California 90033 [R. V. N. L., J. B., P. V. D.];
University of California, Davis Cancer Center, Sacramento, California
95817 [D. G., P. H. G.]; Hospital Arnau de Vilanova, 46015 Valencia,
Spain [V. A.]; Hospital General de Valencia, 46014 Valencia, Spain
[C.C.]; Fundación Jiménez Diaz, 28005 Madrid, Spain [M. D.];
Institut Català d’Oncologia, 08907 Bellvitge, Barcelona, Spain
[F. C.]; Hospital Germans Trias i Pujol, Badalona, s/n 08916
Barcelona, Spain [J. M. S., M. T., R. R.]; Free University of Madrid,
28029 Madrid, Spain [J. J. S.]; and Response Genetics, Los Angeles,
California 90033 [K. D. D.]
ABSTRACT
Purpose: Overexpression of the excision repair crosscomplementing 1 (ERCC1) gene, which is crucial in the
repair of cisplatin (CDDP)-DNA adducts, is reported to
negatively influence the effectiveness of CDDP-based therapy for gastric and ovarian cancers. Recent evidence indicates that Gemcitabine (Gem) may modulate ERCC1 nucleotide excision repair activity, and down-regulation of DNA
repair activity by ERCC1 antisense RNA reportedly inhibits
synergism of CDDP/Gem. We investigated whether ERCC1
mRNA expression levels were associated with clinical outcomes after treatment with a combination Gem/CDDP regimen for patients with advanced stage non-small cell lung
cancer (NSCLC).
Experimental Design: Response and survival were correlated with the level of ERCC1 expression in 56 patients
Received 12/11/01; revised 4/15/02; accepted 4/15/02.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
1
Funded in part by NIH/National Cancer Institute Grant CA 63265 (to
D. G.), Grant CA 71716 (to P. V. D.), and Grants CM 17101 and CA
62505 to University of California, Davis Cancer Center (to D. G. and
P. H. G.), and a grant from the University of Southern California (to
K. D. D. and P. V. D.).
2
Both authors contributed equally to this work.
3
To whom requests for reprints should be addressed, at Hospital Germans Trias i Pujol, Medical Oncology Service, Ctra de Canyet, s/n
08916 Badalona, Barcelona, Spain. Phone: 3493-497-8925; Fax: 3493497-8950; E-mail: rrosell@ns.hugtip.scs.es.
with advanced (stage IIIb or IV) NSCLC treated as part of
a multicenter randomized trial with Gem 1250 mg/m2 days
1 and 8 plus CDDP 100 mg/m2 on day 1 every 3 weeks.
mRNA was isolated from paraffin-embedded pretreatment
primary tumor specimens, and relative expression levels of
ERCC1/␤-actin were measured using a quantitative reverse
transcription-PCR (Taqman) system.
Results: ERCC1 expression was detectable in all tumors. There were no significant differences in ERCC1 levels
by gender, age, performance status, weight loss, or tumor
stage. The overall response rate was 44.7%. There were no
significant associations between ERCC1 expression and response. Median overall survival was significantly longer in
patients with low ERCC1 expression tumors (61.6 weeks;
95% confidence interval, 42.4 – 80.7 weeks) compared to
patients with high expression tumors (20.4 weeks, 95% confidence interval, 6.9 –33.9 weeks). ERCC1 expression, Eastern Cooperative Oncology Group performance status, and
presence of weight loss were significant prognostic factors
for survival in a Cox proportional hazards multivariable
analysis.
Conclusions: These data suggest that ERCC1 expression
is a predictive factor for survival after CDDP/Gem therapy
in advanced NSCLC. Although there was a trend toward
decreased response with high ERCC1 mRNA levels, this
difference failed to reach statistical significance. This result
may reflect the impact of Gem and the requirement for
ERCC1 expression for CDDP/Gem synergism or may be
attributable to the relatively small patient sample size in this
study. Prospective studies of ERCC1 as a predictive marker
for activity of CDDP-based regimens in NSCLC are warranted.
INTRODUCTION
Lung cancer is the leading cause of cancer death in both
men and women in many countries, including Spain and the
United States. More than 75% of lung cancers are NSCLC.4
Except for some patients with surgically resectable disease, the
prognosis for patients with NSCLC is poor. Platinum-based
chemotherapy has been shown to provide survival and quality of
life benefits for patients with advanced stage, unresectable
NSCLC, but overall 2-year survival rates for this group remain
⬍15% (1, 2).
4
The abbreviations used are: NSCLC, non-small cell lung cancer;
CDDP, cisplatin, cis-diamminedichloroplatinum; Gem, Gemcitabine,
2⬘,2⬘-difluorodeoxycytidine; ERCC1, excision repair cross-complementing gene 1; XPA, xeroderma pigmentosum group A protein;
ECOG, Eastern Cooperative Oncology Group; SLCG, Spanish Lung
Cancer Group; CI, confidence interval.
Clinical Cancer Research 2287
Pharmacogenetics, the study of genes that influence drug
activity and toxicity, offers the possibility of tailoring therapy to
the specific genetic profile of individual patients and tumors. A
pharmacogenetic approach can thus potentially increase response rates and survival outcomes while decreasing toxicity
and overall treatment costs. The cytotoxic effect of the anticancer drug CDDP is principally attributable to the formation of
bulky intrastrand platinum-DNA adducts. Removal of these
adducts from genomic DNA is mediated by the nucleotide
excision repair pathway, (3, 4), a critical element of which for
this function is the ERCC1 gene (3, 5, 6). DNA repair can be
attenuated by blocking the interaction between ERCC1 protein
and the XPA (7), and high ERCC1 expression is associated with
resistance to platinum-containing therapy in human ovarian and
gastric tumor specimens (8, 9). Cytotoxic synergism has been
demonstrated between Gem and CDDP, (10 –13), and a higher
response rate was found for the combination of Gem plus CDDP
compared with a standard CDDP plus etoposide regimen in
patients with advanced NSCLC (14). Importantly, this Gem/
CDDP synergism has been shown to involve ERCC1 and the
nucleotide excision repair pathway; expression of ERCC1 antisense RNA abrogates gemcitabine-mediated cytotoxic synergism with CDDP in vitro in human colon cancer cells defective
in mismatch repair but proficient in nucleotide excision repair
(15). In this study, we investigated whether these in vitro findings apply in vivo by measuring ERCC1 mRNA levels in primary NSCLC tissues and correlating these with the clinical
outcomes for patients treated as part of a prospective randomized trial with a combined Gem/CDDP regimen.
MATERIALS AND METHODS
Patients and Samples. Clinical data were retrieved from
the medical and trial database records of patients with advanced
NSCLC who were treated with a standardized Gem/CDDP
regimen at various hospitals of the SLCG. All patients were
enrolled in the Gem/CDDP arm of a prospective multicenter
three-arm randomized trial (GECP/98-02), the SLCG Phase III
trial of Gem/CDDP versus Gem/CDDP/vinorelbine versus sequential doublets of Gem/vinorelbine followed by ifosfamide/
vinorelbine in advanced NSCLC (16). The patients were treated
between October 1998 and September 2000. All patients received Gem 1250 mg/m2 on days 1 and 8 plus CDDP 100
mg/m2 on day 1 every 3 weeks. Eligibility criteria for GECP/
98-02 were measurable stage IV (with brain metastases eligible
if asymptomatic) or stage IIIB (malignant pleural and/or pericardial effusion and/or supraclavicular adenopathy) NSCLC and
ECOG performance score 0 –2.
All patients had chest X-ray and a computed tomography
scan of the chest and upper abdomen before entry into the study
and underwent repeat evaluations at least every 6 weeks. Tumor
response was assessed according to WHO criteria as complete
response, partial response, stable disease, and progressive disease. Tumors were reassessed during treatment with the same
imaging methods used to establish the baseline tumor measurement. All patients gave signed informed consent, and the study
was approved by the institutional ethics review boards. Archival
primary tumor specimens from each patient were retrieved from
the participating SLCG centers after review of the H&E-stained
slides.
RNA Isolation and cDNA Synthesis. RNA isolation
from paraffin-embedded specimens was done according to a
proprietary procedure (US patent number 6,248,535). After
RNA isolation, cDNA was prepared from each sample as described previously (17).
Reverse Transcription-PCR Quantification of mRNA
Expression. Relative cDNA quantitation for ERCC1 and an
internal reference gene (␤-actin) was done using a fluorescencebased, real-time detection method (ABI PRISM 7700 Sequence
Detection System; TaqMan; Applied Biosystems, Foster City,
CA), as described previously (17–19).
The primers and probe sequences used are given below. In
each case, the first primer is the forward PCR primer, the second
is the reverse PCR primer, and the third is the Taqman probe:
ERCC1, GGGAATTTGGCGACGTAATTC, GCGGAGGCTGAGGAACAG, and 6FAM (carboxyfluorescein) 5⬘-CACAGGTGCTCTGGCCCAGCACATA-3⬘TAMRA (N,N,N⬘,N⬘-tetramethyl-6-carboxyrhodamine); ␤-actin, TGAGCGCGGCTACAGCTT, TCCTTAATGTCACGCACGATTT, and 6FAM5⬘ACCACCACGGCCGAGCGG-3⬘TAMRA.
The PCR reaction mixture consisted of 600 nM of each
primer, 200 nM probe, 2.5 units of AmpliTaq Gold polymerase,
200 ␮M each dATP, dCTP, dGTP, 400 ␮M dUTP, 5.5 mM
MgCl2, and 1⫻ Taqman Buffer A containing a reference dye, to
a final volume of 25 ␮l (all reagents were from Applied Biosystems, Foster City, CA). Cycling conditions were 50°C for
10 s, 95°C for 10 min, followed by 46 cycles at 95°C for 15 s
and 60°C for 1 min. Colon, liver, and lung RNAs (all from
Stratagene, La Jolla, CA) were used as control calibrators on
each plate. All gene expression analyses were performed in a
blinded fashion with the laboratory investigators unaware of the
clinical data.
Statistical Analysis. TaqMan analyses yield values that
are expressed as ratios between two absolute measurements
(gene of interest/internal reference gene). The Mann-Whitney t
test was used to test for significant associations between the
continuous test variable ERCC1 expression and dichotomous
variables (patient sex, age above and below the median age,
presence of weight loss, presence of pleural effusion, and tumor
stage). The Kruskal-Wallis test was used to test for significant
differences in ERCC1 expressions within multiple groups
(ECOG performance status and histology). Fisher’s exact test
was used for the analysis of categorical clinicopathological
values including response and dichotomized ERCC1 values.
All patients were followed from first study treatment until
death or until the data were censored, with the patient considered to be alive as of April 2001. Kaplan-Meier survival curves
and the log-rank test were used to analyze univariate distributions for survival and disease-free survival. The maximal ␹2
method of Miller and Siegmund (20) and Halpern (21) was
adapted to determine which expression value best segregated
patients into poor and good prognosis subgroups (in terms of
likelihood of surviving), with the log-rank test as the statistic
used to measure the strength of the grouping. To determine a P
that would be interpreted as a measure of the strength of the
association based on the maximal ␹2 analysis, 1000 boot-straplike simulations were used to estimate the distribution of the
2288 ERCC1 Expression and Survival in NSCLC
Table 1
Patient characteristics
n (%)
No. of patients
Sex
Male
Female
Age, yr
Median
Range
ECOG performance status
0
1
2
Weight loss
Stage
IIIB
IV
Pleural effusion
Histopathology
Adenocarcinoma
Squamous cell carcinoma
Large cell carcinoma
Unspecified
Response
Complete response
Partial response
Stable disease
Progressive disease
Not evaluablea
a
56 (100)
48 (85.7)
8 (14.3)
60.5
32–75
13 (23.2)
35 (62.5)
8 (14.3)
21 (37.5)
16 (28.6)
40 (71.4)
11 (19.6)
30 (53.6)
20 (35.7)
4 (7.1)
2 (3.6)
3 (5.4)
18 (32.1)
8 (14.3)
18 (32.1)
9 (16.1)
Due to early death or malignant pleural effusion.
maximal ␹2 statistics under the hypothesis of no association
(21). Cox’s proportional hazards modeling of factors that were
significant in univariate analysis was performed to identify
which factors might have a significant influence on survival.
SPSS version 10.0.5 software (SPSS, Inc., Chicago, IL) was
used for all statistical analyses. All Ps were two-sided.
RESULTS
Patient and Tumor Characteristics. Demographic details on the 56 patients included in the study and tumor stage and
cell type details are shown in Table 1. The median number of
treatment cycles received was three (range, one to six). Three of
the 56 patients had received radiotherapy, and 5 patients had
undergone surgical resection of the primary tumor.
ERCC1 Expression Levels. ERCC1 mRNA expression
was detectable in all 56 samples analyzed. The median ERCC1
expression, relative to the expression of the internal control
housekeeping gene ␤-actin, was 6.7 ⫻ 10⫺3 (range, 0.8 ⫻ 10⫺3
to 24.6 ⫻ 10⫺3; values shown hereafter without x 10⫺3, e.g.,
median, 6.7). Twenty-eight (50%) patients had an ERCC1 level
greater than the median, and 50% had a level ⬍6.7. There were
no significant associations between ERCC1 levels and any of
the factors age (P ⫽ 0.66), sex (P ⫽ 0.18), presence of weight
loss in the 6 months before randomization (P ⫽ 0.74), tumor
stage (IIIB versus IV; P ⫽ 0.39), or presence of pleural effusion
(P ⫽ 0.25, all Mann-Whitney t test). There were also no
significant differences between the ERCC1 levels among patients with different performance status grades (P ⫽ 0.48,
Kruskal-Wallis test) or different tumor cell types (all four tumor
types, P ⫽ 0.10, Kruskal-Wallis test), but ERCC1 expression
Fig. 1 Kaplan-Meier survival curve for patients with intratumoral
ERCC1 levels above and below the median ERCC1 level.
levels were significantly higher in squamous cell carcinomas
(median, 8.6) compared with adenocarcinomas (median, 5.2;
P ⫽ 0.015, Mann-Whitney test).
Response to Chemotherapy. The tumor response frequencies for the 47 patients who were evaluable for response are
shown in Table 1. The overall response rate was 44.7%. The
ERCC1 expression levels in the complete response and partial
response, i.e., “responding” tumors (median, 4.3; range, 1.2–
24.6) were not significantly different from the levels in the
stable disease and progressive disease, i.e., “non-responding”
tumors (median, 7.85; range, 0.8 –24.3; P ⫽ 0.31, Mann-Whitney test). There were also no significant differences between the
proportion of responding and nonresponding tumors with
ERCC1 values greater and less than any ERCC1 level (all
Fisher’s exact test). The response rate in tumors with ERCC1
expression below the median value (“low” expression, 52%
responders) was higher than for tumors with ERCC1 expression
above the median value (“high” expression, 36.4% responders;
Fisher’s exact test, P ⫽ 0.38).
Association between Patient Overall Survival and
ERCC1 Levels. The median overall survival time was 36.6
weeks (range, 0 –113.4 weeks), and the median time to progression was 24.4 weeks (range, 0 –102.9 weeks). Use of the logrank test and the maximal ␹2 statistic to identify ERCC1 levels
that segregated patients into poor and good prognosis subgroups
showed that the range of discriminatory values included the
median value, which was therefore used as the cutoff value for
the survival analysis. Fig. 1 shows the Kaplan-Meier survival
curve for patients with intratumoral ERCC1 levels above and
below the median ERCC1 level. As shown in Table 2, patients
with ERCC1 levels below the median had a significantly longer
median survival of 61.6 weeks (95% CI, 42.4 – 80.7 weeks)
compared with 20.4 weeks (95% CI, 6.9 –33.9 weeks) for patients with ERCC1 levels above the median. Adjusted for tumor
stage, the log-rank statistic for the association between low or
high ERCC1 expression and overall survival was 3.97, and the P
was 0.046. The unadjusted log-rank results are shown in Table 2.
Clinical Cancer Research 2289
Table 2
Factors associated with overall survival
Univariable analysis
ERCC1 expression
Lowa
Higha
Weight loss
Absent
Present
ECOG performance status
0
1
2
Median
survival (wk)
Log-rank
statistic
62
20
6.78
46
14
61
31
5
Multivariable analysis
Hazard ratio
(95% CI)
P
0.009
0.32 (0.14–0.71)
0.005
8.89
⬍0.003
0.36 (0.17–0.75)
0.007
10.29
⬍0.005
(0 vs. 1 or 2)
0.26 (0.09–0.76)
0.014
P
a
ERCC1 expression values are categorized according to whether there was less than the ERCC1 median value of 6.7 (“low expression”) or
greater than the median (“high expression”).
An ERCC1 cutoff value of 5.8 was tested because this
value was shown in a previous study to be associated with
overall survival for patients with gastric cancer (9). Overall
survival was significantly better for the group of NSCLC patients in this study with ERCC1 levels ⬍5.8 (median, 74.71
weeks; 95% CI, 71.77–77.66 weeks) compared with those with
ERCC1 levels ⬍5.8 (median, 61.0 weeks; 95% CI, 45.61–76.39
weeks; unadjusted log-rank statistic, 6.37; P ⫽ 0.011).
Other factors that were significantly associated with overall
survival on univariable analysis using Kaplan Meier survival
curves and the log-rank test were the presence of pretreatment
weight loss and the ECOG performance status (Table 2). Patient
age (P ⫽ 0.18), sex (P ⫽ 0.87), tumor stage (P ⫽ 0.99), tumor
cell type (SCC versus adenocarcinoma P ⫽ 0.63), and presence
of pleural effusion (P ⫽ 0.71) were not significant prognostic
factors for overall survival. ERCC1 level, ECOG performance
status, and weight loss remained significant prognostic factors
for survival in the Cox proportional hazards regression model
multivariable analysis (Table 2). Ps for a Cox regression model
stratified on tumor stage were 0.038 for ERCC1, 0.017 for
weight loss and 0.02 for ECOG performance status (performance status 0 versus 1 or 2).
DISCUSSION
This study found an association between lower ERCC1
mRNA expression levels and improved survival after treatment
with a combination Gem/CDDP regimen for patients with advanced stage NSCLC. Experimental studies have shown that
high ERCC1 levels are associated with increased removal of
CDDP-induced DNA adducts and relative CDDP resistance (5),
and ERCC1-defective cells or knockout mice are highly sensitive to DNA cross-linking agents (22, 23). Lee et al. (24)
showed that transfecting ERCC1 into a UV repair-deficient
[ERCC1(⫺)] Chinese hamster ovary cell line conferred DNA
adduct repair capability and CDDP resistance. These findings
suggest that the likely explanation for our results is that intratumoral ERCC1 levels are associated with the effectiveness of
CDDP therapy because ERCC1 expression influences ERCC1mediated DNA adduct repair activity (25).
Confidence in our results is derived from the fact that,
although the genetic analysis was performed retrospectively
after the trial was closed, the clinical data were collected prospectively under the conditions of a multicenter randomized
trial, and the laboratory work was performed in a blinded
fashion. Furthermore, other studies have also found an association between lower intratumoral ERCC1 expressions and improved clinical outcomes for patients treated with platinumcontaining regimens. Metzger et al. (9) found a significant
association between ERCC1 levels and survival after CDDP/5fluorouracil therapy for patients with gastric cancer. Metzger et
al. (9) used a cutoff ERCC1 mRNA expression value of 5.8,
which also divided patients in a statistically significant way into
good and poor survival arms in our study, although a higher
ERCC1 level was a more powerful discriminator. Dabholkar et
al. (26) reported that patients with ovarian cancer who were
clinically resistant to platinum-based therapy had a statistically
significant 2.6-fold higher expression level of ERCC1 in their
tumor tissue than patients who responded to that therapy. A
further study showed that both ERCC1 and XPAC (the human
excision repair gene that corrects the defect in xeroderma pigmentosum group A cells) were important for response to platinum-based chemotherapy in ovarian cancer tissues (8). Other
studies have also reported associations between higher ERCC1
expressions and worse clinical outcomes for CDDP-based therapy for esophageal cancer (27, 28) and for oxaliplatin/5-fluorouracil treatment for colorectal cancer (29).
In addition to associations with survival outcomes, several
of these studies found associations between ERCC1 expression
and chemoresponse (8, 9, 26, 28, 29). These studies included
patients treated with CDDP but not with Gem. A significant
association with response was not found in our study, but this
finding was not unexpected because of the requirement for
ERCC1 for CDDP/Gem synergism (15). Despite this requirement, ERCC1 levels remain important, as indicated by the
association with survival and the trend toward a lower response
rate in patients with high ERCC1 mRNA tumor levels. It is also
noteworthy that the 52% response rate in the low ERCC1 group
is considerably higher than the 21– 40.6% response rates reported in other CDDP/Gem NSCLC randomized trials (14,
30 –32).
Cisplatin- or carboplatin-containing regimens have been
considered a standard of care in the therapy of advanced stage
2290 ERCC1 Expression and Survival in NSCLC
NSCLCs for ⬎15 years (1). Recently, randomized studies have
sought to determine whether nonplatinum combinations of
newer agents were either more efficacious or less toxic. Results
have been inconclusive, suggesting that a therapeutic plateau for
currently available chemotherapy has been reached (33–38).
Instead, novel therapeutic approaches will likely be required to
optimize chemotherapy effectiveness in individual patients, and
the use of potential molecular predictors of response and survival in individual NSCLC patients may well become important
criteria for chemotherapy selection (39, 40). Recent studies of
NSCLC cells or tissues have identified several potentially valuable chemosensitivity markers in addition to ERCC1 (8, 39,
41– 43), but validation of these markers is still required. Another
potential clinical consequence of our findings is that, as suggested by Li et al. (5), pharmacological approaches that inhibit
ERCC1 expression may increase cellular sensitivity to CDDP.
UCN-01 (7-hydroxylstaurosporine) is a cell cycle checkpoint
abrogator that has been shown to inhibit nucleotide excision
repair, attenuate the interaction of ERCC1 with XPA (7), and
potentiate CDDP cytotoxicity (44). In the present study, the
multivariate analyses confirmed the strength of the ERCC1
mRNA levels, which was even more significant than that of
performance status. Further validation of these findings could
lead to a dramatic change in clinical practice, avoiding unnecessary CDDP chemotherapy in almost half of NSCLC patients.
The Preliminary Genotypic International Lung Trial, a prospective randomized trial testing the importance of ERCC1 expression and other factors for CDDP effectiveness in NSCLC patients, is under way.
REFERENCES
1. Bunn, P. A., Jr., and Kelly, K. New chemotherapeutic agents prolong
survival and improve quality of life in non-small cell lung cancer: a
review of the literature and future directions. Clin. Cancer Res., 4:
1087–1100, 1998.
2. Non-small Cell Lung Cancer Collaborative Group. Chemotherapy in
non-small cell lung cancer: a meta-analysis using updated data on
individual patients from 52 randomised clinical trials. Br. Med. J., 311:
899 –909, 1995.
3. Reed, E. Platinum-DNA adduct, nucleotide excision repair and platinum based anti-cancer chemotherapy. Cancer Treat. Rev., 24: 331–344,
1998.
4. Reardon, J. T., Vaisman, A., Chaney, S. G., and Sancar, A. Efficient
nucleotide excision repair of cisplatin, oxaliplatin, and bis-acetoammine-dichloro-cyclohexylamine-platinum(IV) (JM216) platinum
intrastrand DNA diadducts. Cancer Res., 59: 3968 –3971, 1999.
5. Li, Q., Yu, J. J., Mu, C., Yunmbam, M. K., Slavsky, D., Cross, C. L.,
Bostick-Bruton, F., and Reed, E. Association between the level of
ERCC-1 expression and the repair of cisplatin-induced DNA damage in
human ovarian cancer cells. Anticancer Res., 20: 645– 652, 2000.
6. Yu, J. J., Lee, K. B., Mu, C., Li, Q., Abernathy, T. V., BostickBruton, F., and Reed, E. Comparison of two human ovarian carcinoma
cell lines (A2780/CP70 and MCAS) that are equally resistant to platinum, but differ at codon 118 of the ERCC1 gene. Int. J. Oncol., 16:
555–560, 2000.
7. Jiang, H., and Yang, L. Y. Cell cycle checkpoint abrogator UCN-01
inhibits DNA repair: association with attenuation of the interaction of
XPA and ERCC1 nucleotide excision repair proteins. Cancer Res., 59:
4529 – 4534, 1999.
8. Dabholkar, M., Vionnet, J., Bostick-Bruton, F., Yu, J. J., and Reed,
E. Messenger RNA levels of XPAC and ERCC1 in ovarian cancer tissue
correlate with response to platinum-based chemotherapy. J. Clin. Investig., 94: 703–708, 1994.
9. Metzger, R., Leichman, C. G., Danenberg, K. D., Danenberg, P. V.,
Lenz, H. J., Hayashi, K., Groshen, S., Salonga, D., Cohen, H., Laine, L.,
Crookes, P., Silberman, H., Baranda, J., Konda, B., and Leichman, L.
ERCC1 mRNA levels complement thymidylate synthase mRNA levels
in predicting response and survival for gastric cancer patients receiving
combination cisplatin and fluorouracil chemotherapy. J. Clin. Oncol.,
16: 309 –316, 1998.
10. van Moorsel, C. J., Pinedo, H. M., Veerman, G., Bergman, A. M.,
Kuiper, C. M., Vermorken, J. B., van der Vijgh, W. J., and Peters, G. J.
Mechanisms of synergism between cisplatin and gemcitabine in ovarian
and non-small-cell lung cancer cell lines. Br. J. Cancer, 80: 981–990,
1999.
11. Bergman, A. M., Ruiz, V. H. V., Veerman, G., Kuiper, C. M., and
Peters, G. J. Synergistic interaction between cisplatin and gemcitabine
in vitro. Clin. Cancer Res., 2: 521–530, 1996.
12. Rosell, R., Tonato, M., and Sandler, A. The activity of gemcitabine
plus cisplatin in randomized trials in untreated patients with advanced
non-small cell lung cancer. Semin. Oncol., 25: 27–34, 1998.
13. Edelman, M. J., Quam, H., and Mullins, B. Interactions of gemcitabine, carboplatin and paclitaxel in molecularly defined non-small-cell
lung cancer cell lines. Cancer Chemother. Pharmacol., 48: 141–144,
2001.
14. Cardenal, F., Lopez-Cabrerizo, M. P., Anton, A., Alberola, V.,
Massuti, B., Carrato, A., Barneto, I., Lomas, M., Garcia, M., Lianes, P.,
Montalar, J., Vadell, C., Gonzalez-Larriba, J. L., Nguyen, B., Artal, A.,
and Rosell, R. Randomized Phase III study of gemcitabine-cisplatin
versus etoposide-cisplatin in the treatment of locally advanced or metastatic non-small-cell lung cancer. J. Clin. Oncol., 17: 12–18, 1999.
15. Yang, L. Y., Li, L., Jiang, H., Shen, Y., and Plunkett, W. Expression
of ERCC1 antisense RNA abrogates Gemicitabine-mediated cytotoxic
synergism with cisplatin in human colon tumor cells defective in mismatch repair but proficient in nucleotide excision repair. Clin. Cancer
Res., 6: 773–781, 2000.
16. Alberola, V., Camps, C., Provencia, M., Rosell, R., Vadell, C.,
Bover, I., Rui Zcasado, A., Azagra, P., Jiménez, U., González-Larriba,
J., Cardenal, F. A. A., Carrato, A., Morales, S., and Sánchez, J. Cisplatin/Gemcitabine (CG) versus cisplatin/Gemcitabine/vinorelbine (CGV)
versus sequential doublets of Gemcitabine/vinorelbine followed by ifosfamide/vinorelbine (GV/IV) in advanced NSCLC: results of a Spanish
Lung Cancer Group Phase III trial (GEPC/98-02). Proc. Am. Soc. Clin.
Oncol., 20: 308a, 2001.
17. Lord, R. V., Salonga, D., Danenberg, K. D., Peters, J. H., DeMeester, T. R., Park, J. M., Johansson, J., Skinner, K. A., Chandrasoma,
P., DeMeester, S. R., Bremner, C. G., Tsai, P. I., and Danenberg, P. V.
Telomerase reverse transcriptase expression is increased early in the
Barrett’s metaplasia, dysplasia, adenocarcinoma sequence. J. Gastrointest. Surg., 4: 135–142, 2000.
18. Gibson, U. E., Heid, C. A., and Williams, P. M. A novel method for
real time quantitative RT-PCR. Genome Res., 6: 995–1001, 1996.
19. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. Real time
quantitative PCR. Genome Res., 6: 986 –994, 1996.
20. Miller, R., and Siegmund, D. Maximally selected ␹2 statistics.
Biometrics, 38: 1011–1016, 1982.
21. Halpern, J. Maximally selected ␹2 statistics for small samples.
Biometrics, 38: 1017–1023, 1982.
22. Westerveld, A., Hoeijmakers, J. H., van Duin, M., de Wit, J., Odijk,
H., Pastink, A., Wood, R. D., and Bootsma, D. Molecular cloning of a
human DNA repair gene. Nature (Lond.), 310: 425– 429, 1984.
23. Melton, D. W., Ketchen, A. M., Nunez, F., Bonatti-Abbondandolo,
S., Abbondandolo, A., Squires, S., and Johnson, R. T. Cells from
ERCC1-deficient mice show increased genome instability and a reduced
frequency of S-phase-dependent illegitimate chromosome exchange but
a normal frequency of homologous recombination. J. Cell Sci., 111:
395– 404, 1998.
24. Lee, K. B., Parker, R. J., Bohr, V., Cornelison, T., and Reed, E.
Cisplatin sensitivity/resistance in UV repair-deficient Chinese hamster
ovary cells of complementation groups 1 and 3. Carcinogenesis (Lond.),
14: 2177–2180, 1993.
Clinical Cancer Research 2291
25. Chaney, S. G., and Sancar, A. DNA repair: enzymatic mechanisms
and relevance to drug response. J. Natl. Cancer Inst., 88: 1346 –1360,
1996.
26. Dabholkar, M., Bostick-Bruton, F., Weber, C., Bohr, V. A.,
Egwuagu, C., and Reed, E. ERCC1 and ERCC2 expression in malignant
tissues from ovarian cancer patients. J. Natl. Cancer Inst., 84: 1512–
1517, 1992.
27. Moore-Joshi, M. H., Danenberg, K. D., Lord, R. V., Johansson, J.,
Uetake, H., Danenberg, P. V., and Harpole, D. H., Jr. Low thymidylate
synthase and ERCC1 gene expressions are associated with increased
survival after neoadjuvant 5-FU/cisplatin/radiotherapy for esophageal
adenocarcinoma. Proc. Am. Soc. Clin. Oncol., 19: 244A, 2000.
28. Metzger, R., Schneider, P. M., Baldus, S. E., et al. Quantitative
ERCC1 RNA expression identifies non-response to cis-platinum based
neoadjuvant radiochemotherapy for esophageal cancer. Proc. Am. Soc.
Clin. Oncol., 20: 130a, 2001.
29. Shirota, Y., Stoehlmacher, J., Brabender, J., Xiong, Y., Uetake, H.,
Danenberg, K. D., Groshen, S., Tsao-Wei, D. D., Danenberg, P. V., and
Lenz, H. ERCC1 and thymidylate synthase mRNA levels predict survival for colorectal cancer patients receiving combination oxaliplatin
and fluorouracil chemotherapy. J. Clin. Oncol., 19: 4298 – 4304, 2001.
30. Sandler, A. B., Nemunaitis, J., Denham, C., von Pawel, J., Cormier,
Y., Gatzemeier, U., Mattson, K., Manegold, C., Palmer, M. C., Gregor,
A., Nguyen, B., Niyikiza, C., and Einhorn, L. H. Phase III trial of
gemcitabine plus cisplatin versus cisplatin alone in patients with locally
advanced or metastatic non-small-cell lung cancer. J. Clin. Oncol., 18:
122–130, 2000.
31. Crino, L., Scagliotti, G. V., Ricci, S., De Marinis, F., Rinaldi, M.,
Gridelli, C., Ceribelli, A., Bianco, R., Marangolo, M., Di Costanzo, F.,
Sassi, M., Barni, S., Ravaioli, A., Adamo, V., Portalone, L., Cruciani,
G., Masotti, A., Ferrara, G., Gozzelino, F., and Tonato, M. Gemcitabine
and cisplatin versus mitomycin, ifosfamide, and cisplatin in advanced
non-small-cell lung cancer: a randomized Phase III study of the Italian
Lung Cancer Project. J. Clin. Oncol., 17: 3522–3530, 1999.
32. Schiller, J. H., Harrington, D., Belani, C., Langer, C., Sandler, A.,
Krook, J., Zhu, J., and Johnson, D. H. Comparison of four chemotherapy
regimens for advanced non-small-cell lung cancer. N. Engl. J. Med.,
346: 92–98, 2002.
33. Georgoulias, V., Papadakis, E., Alexopoulos, A., Tsiafaki, X.,
Rapti, A., Veslemes, M., Palamidas, P., Vlachonikolis, I., and the Greek
Oncology Cooperative Group G. Platinum-based and non-platinumbased chemotherapy in advanced non-small-cell lung cancer: a randomised multicentre trial. Lancet, 357: 1478 –1484, 2001.
34. Gridelli, C., Perrone, F., Palmeri, S., D’Aprile, M., Cognetti, F.,
Rossi, A., Gebbia, V., Pepe, R., Veltri, E., Airoma, G., Russo, A.,
Incoronato, P., Scinto, A. F., Palazzolo, G., Natali, M., Leonardi, V.,
Gallo, C., De Placido, S., and Bianco, A. R. Mitomycin C plus vindesine
plus etoposide (MEV) versus mitomycin C plus vindesine plus cisplatin
(MVP) in stage IV non-small-cell lung cancer: a Phase III multicentre
randomised trial. The “Gruppo Oncologico Centro-Sud-Isole”
(G. O. C. S. I.). Ann. Oncol., 7: 821– 826, 1996.
35. Gatzemeier, U., Heckmayr, M., Hossfeld, D. K., Kaukel, E., Koschel, G., and Neuhauss, R. A randomized trial with mitomycin-C/
ifosfamide versus mitomycin-C/vindesine versus cisplatin/etoposide in
advanced non-small-cell lung cancer. Am. J. Clin. Oncol., 14: 405– 411,
1991.
36. Kosmidis, P. A., Bacoyiannis, C., Mylonakis, N., et al. A randomized Phase III trial of paclitaxel plus carboplatin versus paclitaxel plus
gemcitabine in advanced non small cell lung cancer (NSCLC). A
preliminary analysis. Proc. Am. Soc. Clin. Oncol., 19: 488, 2000.
37. Yamamoto, N., Fukuoka, M., Nakagawa, K., et al. Randomized
Phase II study of docetaxel (DOC) plus cisplatin (CDDP) versus DOC
plus irinotecan in advanced non-small cell lung cancer (NSCLC): A
West Japan Thoracic Oncology Group (WJTOG) study. Ann. Oncol., 11
(Suppl. 4): S107, 2000.
38. Van Meerbeeck, J. P., Smit, E. F., Lianes, P., Schramel, F., Lenz,
M., Debruyne, C., and Giaccone, G. A EORTC randomized Phase III
trial of three chemotherapy regimens in advanced non-small-cell lung
cancer (NSCLC). Proc. Am. Soc. Clin. Oncol., 20: 308a, 2001.
39. Rosell, R., Taron, M., and O’Brate, A. Predictive molecular markers in non-small cell lung cancer. Curr. Opin. Oncol., 13: 101–109,
2001.
40. Rosell, R., Green, M., and Gumerlock, P. Advances in the treatment
of non-small cell lung cancer: molecular markers take the stage. Semin.
Oncol., 28: 28 –34, 2001.
41. Young, L. C., Campling, B. G., Cole, S. P., Deeley, R. G., Gerlach,
J. H. Multidrug resistance proteins MRP3. MRP1, and MRP2 in lung
cancer: correlation of protein levels with drug response and messenger
RNA levels. Clin. Cancer Res., 7: 1798 –1804, 2001.
42. Mack, P. C., Gandara, D. R., Bowen, C., Edelman, M. J., Paglieroni, T., Schnier, J. B., Gelmann, E. P., and Gumerlock, P. H. RB status
as a determinant of response to UCN-01 in non-small cell lung carcinoma. Clin. Cancer Res., 5: 2596 –2604, 1999.
43. Monzo, M., Rosell, R., Sanchez, J. J., Lee, J. S., O’Brate, A.,
Gonzalez-Larriba, J. L., Alberola, V., Lorenzo, J. C., Nunez, L., Ro,
J. Y., and Martin, C. Paclitaxel resistance in non-small-cell lung cancer
associated with ␤-tubulin gene mutations. J. Clin. Oncol., 17: 1786 –
1793, 1999.
44. Pollack, I. F., Kawecki, S., and Lazo, J. S. Blocking of glioma
proliferation in vitro and in vivo and potentiating the effects of BCNU
and cisplatin: UCN-01, a selective protein kinase C inhibitor. J. Neurosurg., 84: 1024 –1032, 1996.
Vol. 10, 4215s– 4219s, June 15, 2004 (Suppl.)
Clinical Cancer Research 4215s
Gene Expression as a Predictive Marker of Outcome in Stage
IIB-IIIA-IIIB Non-Small Cell Lung Cancer After
Induction Gemcitabine-Based Chemotherapy
Followed By Resectional Surgery
Institut Catala d’Oncologia, Medical Oncology Service, Hospital
Germans Trias i Pujol, Barcelona; 2Medical Oncology Service,
3
Pathology Department, 4Autonomous University of Madrid, Madrid,
Spain; and 5Department of Thoracic Surgery, Hospital Vall d’Hebron,
Barcelona
(65% versus 54%; P ⴝ 0.24), complete resections (94%
versus 72%; P ⴝ 0.03), lobectomies (71% versus 34%; P ⴝ
0.004), and pathological complete responses (29% versus
0%; P ⴝ 0.00001)
Conclusions: Patients with RRM1 levels in the bottom
quartile benefited significantly from gemcitabine/cisplatin
neoadjuvant chemotherapy, leading us to conclude that
RRM1 mRNA levels should be additionally validated to
proceed with tailored chemotherapy.
ABSTRACT
INTRODUCTION
Purpose: The first suggestions of a relationship between
gene mRNA expression and differential sensitivity to gemcitabine/cisplatin are now emerging. ERCC1, RRM1, and
XPD are involved in the nucleotide excision repair pathways,
and tumor up-regulation of these genes leads to chemotherapy failure. In the present study, we have examined the
potential correlation and predictive value of ERCC1, RRM1,
and XPD mRNA expression in resected specimens from 67
stage IIB, IIIA, and IIIB non-small cell lung cancer patients
treated with neoadjuvant gemcitabine/platinum followed by
surgery
Experimental Design: ERCC1, RRM1, and XPD expression was quantified using real-time quantitative reverse
transcription-PCR.
Results: A good correlation was found between mRNA
expression levels of the three genes. For RRM1 levels, patients in the bottom quartile had a decreased risk of death
compared with those in the top quartile (risk ratio ⴝ 0.30;
P ⴝ 0.033). Median survival for the 17 patients in the bottom
quartile was 52 months, whereas for the 15 in the top
quartile, it was 26 months (P ⴝ 0.018). When the characteristics of these 17 patients were compared with all of the
other 50 patients, no differences in initial staging were observed. However, the 17 patients in the bottom quartile had
better outcomes, including more radiographic responses
The overall 5-year survival of patients with non-small cell
lung cancer (NSCLC) has remained at ⬍15% for the past 20
years. For patients with clinical stage IIB (T1–2N1M0 and
T3N0M0), 5-year survival is ⬃25%; for those with stage IIIA
(T3N1M0 and T1–2-3N2M0), it is 13%; and for those with
stage IIIB (T4N0 –1-2M0), it bottoms out at 7% (1). Small
randomized studies of neoadjuvant chemotherapy in stage IIIA
(2) or stage IIB-IIIB (3) showed remarkable improvement in
survival over patients treated either with surgery alone or with
surgery followed by adjuvant radiotherapy. Event-free survival
was similar in the two studies: 12.7 (2) and 20 (3) months in the
neoadjuvant chemotherapy arm and 5.8 (2) and 5 (3) months in
the surgery arm.
The efficiency of removal of cisplatin DNA adducts by the
nucleotide excision repair (NER) system is assumed to be one of
the determinants of cisplatin resistance (4, 5). Excision repair
cross-complementation group 1 (ERCC1) is a single-stranded
DNA endonuclease, which forms a tight heterodimer with xeroderma pigmentosum complementation group F. Its role in
NER is to incise DNA on the 5⬘ side of lesions such as cisplatin
DNA adducts. Overexpression of ERCC1 and other NER genes
has been associated with repair of cisplatin-induced DNA damage and clinical resistance to cisplatin (4 – 8), and repair of
cisplatin DNA adducts does not occur in the absence of functional ERCC1 (4 – 8). Ribonucleotide reductase is responsible
for the reduction of ribonucleotides to their corresponding deoxyribonucleotides, providing a balanced supply of precursors
for DNA synthesis and repair. Alterations in ribonucleotide
reductase levels can have significant effects on such biological
properties of cells as tumor promotion and tumor progression
and can potentiate metastasis. It has been reported that transcription coupled-NER-deficient cells, with underexpression of xeroderma pigmentosum group D (XPD), are hypersensitive to
cisplatin regardless of their global genome-NER status.
On the basis of these data, we have examined for the first
time the potential correlation and predictive value of ERCC1,
ribonucleotide reductase subunit M1 (RRM1), and XPD mRNA
expression in resected specimens from stage IIB, IIIA, and IIIB
Rafael Rosell,1 Enriqueta Felip,2 Miquel Taron,1
Joaquim Majo,3 Pedro Mendez,1
Maria Sanchez-Ronco,4 Cristina Queralt,1
Jose Javier Sanchez,4 and Jose Maestre5
1
Presented at the First International Conference on Novel Agents in the
Treatment of Lung Cancer, October 17–18, 2003, Cambridge, Massachusetts.
Grant support: Eli Lilly & Co., Redes Temáticas de Investigación
Cooperativa de Centros de Cáncer (CO-010), Red de Centros de Epidemiologı́a y Salud Pública (RCESP), and by La Fundació Badalona
Contra El Càncer.
Requests for reprints: Rafael Rosell, Medical Oncology Service, Scientific Director of Oncology Research, Institut Català d’Oncologia,
Hospital Germans Trias i Pujol, Ctra Canyet, s/n, 08916 Barcelona,
Spain. Phone: 34-93-497-89-25; Fax: 34-93-497-89-50; E-mail: rrosell@
ns.hugtip.scs.es.
4216s RRM1 mRNA Expression in NSCLC
NSCLC patients treated with neoadjuvant gemcitabine/cisplatin
followed by surgery.
PATIENTS AND METHODS
Patients. The present study composed of 67 consecutive
stage IIB-IIIA-IIIB NSCLC patients from one single institution
(Hospital Vall d’Hebron, Barcelona, Spain). Initially, surgical
resection of both primary disease and hilar/mediastinal nodal
disease was recommended for patients with stage IIB-IIIA
NSCLC, and patients with potentially resectable T4 N0 lesions
(stage IIIB) were also eligible for this study. All of the patients
were medically fit to undergo surgical resection, and they underwent surgery between September 1998 and December 2002,
after receiving neoadjuvant gemcitabine/platinum chemotherapy. Baseline patient characteristics are shown in Table 1.
Patients received three cycles of neoadjuvant chemotherapy; 63
received cisplatin 100 mg/m2 day 1 and gemcitabine 1250
mg/m2 day 1 and 8 every 21 days; and 4 patients with creatinine
clearance ⬍60 ml/min received carboplatin area under the
curve ⫽ 5 day 1 and gemcitabine 1000 mg/m2 day 1 and 8 every
Table 1
Patient characteristics and surgical results for all patients
Characteristic
Sex
Female
Male
Age, years
Median
Range
Histology
Squamous cell carcinoma
Adenocarcinoma
Large-cell carcinoma
Other
Initial staging
IIB
T3N0
IIIA
T3N1
T1N2
T2N2
T3N2
IIIB
T4N0
T4N1
T4N2
Chemotherapy regimen
Gemcitabine/cisplatin
Gemcitabine/carboplatin
Radiographic response
Partial response
Stable disease
Progressive disease
Surgical results
Complete resection
Incomplete resection
Unresectable
Pathologic complete response
Surgical procedures
Lobectomy
Pneumonectomy
Bilobectomy
Unresectable
No. patients
%
7
60
10
90
64
45–76
29
26
11
1
43
39
16
1
6
9
5
—
10
13
7
15
19
20
8
5
30
12
7
63
4
94
6
38
23
6
57
34
9
52
10
5
5
78
15
7
7
29
29
4
5
43
43
6
7
21 days. Clinical tumor response was evaluated after three
chemotherapy cycles according to the Eastern Cooperative Oncology Group criteria for solid-tumor response. A thoracotomy
was performed within 4 –5 weeks after the last chemotherapy
cycle; the surgical procedure was based on the extent of tumor
at the time of the initial presentation.
Laboratory Methods. Total RNA was recovered from
formalin-fixed, paraffin-embedded surgical specimens using
proteinase K digestion and phenol-chloroform extraction as
described previously (9). After cDNA synthesis XPD, ERCC1,
and RRM1 expression was analyzed with real-time quantitative
PCR. Quantification of gene expression was performed using
the ABI Prism 7900HT Sequence Detection System (Applied
Biosystems, Foster City, CA). The primers and 5⬘-labeled probe
were as follows: ␤-actin, forward 5⬘ TGA GCG CGG CTA
CAG CTT 3⬘, reverse 5⬘ TCC TTA ATG TCA CGC ACG ATT
T 3⬘, and probe 5⬘ ACC ACC ACG GCC GAG CGG 3⬘;
ERCC1, forward 5⬘ GGG AAT TTG GCG ACG TAA TTC 3⬘,
reverse 5⬘ GCG GAG GCT GAG GAA CAG 3⬘, probe 5⬘ CAC
AGG TGC TCT GGC CCA GCA CAT A 3⬘; XPD, forward 5⬘
GCT CCC GCA AAA ACT TGT GT 3⬘, reverse 5⬘ CAT CGA
CGT CCT TCC CAA A 3⬘, probe 5⬘ ACC CTG AGG TGA
CAC CCC TGC G 3⬘; and RRM1, forward 5⬘ ACT AAG CAC
CCT GAC TAT GCT ATC C 3⬘, reverse 5⬘ CTT CCA TCA
CAT CAC TGA ACA CTT T 3⬘, probe 5⬘ CAG CCA GGA
TCG CTG TCT CTA ACT TGC A 3⬘.
Relative gene expression quantification was calculated according to the comparative threshold cycle method (2⫺⌬⌬Ct)
using ␤-actin as an endogenous control and commercial RNA
controls (Stratagene, La Jolla, CA) as calibrators.
Statistical Methods. Survival curves were obtained by
the Kaplan-Meier method, and the difference in survival in
subgroups was analyzed using either the log-rank test or TaroneWare test (SPSS 11.5 software). We performed survival analysis
using Cox proportional hazards models. We assessed the fit of
the hazard models by plotting the cumulative hazard of death
against the Cox-Snell residuals. In addition, we assessed the
effect of gene mRNA expression on the relative risk (RR) of
death using gene mRNA expression quartiles. All of the statistical tests were two-sided, and the level of significance was set
at 5%.
RESULTS
Radiographic and surgical results are summarized in Table
1. Pathological complete response occurred in 5 patients (1
patient with radiographic stable disease and 4 patients with
radiographic partial response to chemotherapy). Median overall
survival for all of the patients was 37.80 months [95% confidence interval (CI), 27.04 – 48.56 months], and median eventfree survival for all of the patients was 11.84 months (95% CI,
5.48 –18.21 months). Thirty-day postoperative mortality was
7.5% (5 patients). This included a bronchopleural fistula resulting in death in 1 patient who underwent a bilobectomy; pneumonia and respiratory failure occurred in 2 patients who underwent a right pneumonectomy; a fourth patient died from
respiratory failure after a left pneumonectomy; and the fifth
cause of death was pneumonia after the patient had undergone a
right upper lobectomy.
Clinical Cancer Research 4217s
The 52 completely resected patients attained a median
survival of 45.1 months (95% CI, 24.5– 65.6 months). The 10
patients with incomplete resection and the 5 unresectable patients had a significantly shorter survival [6.8 months (95% CI,
5.5– 8.1 months) and 5.6 months (95% CI, 3.6 –7.5 months),
respectively; log-rank P ⫽ 0.0001]. Twelve of the 67 patients
received postoperative radiotherapy: 5 for residual N2 disease, 3
for rib involvement, and the remaining 4 for unresectable disease. Relapse occurred in 38 patients (57%). Sites of initial
failure included only local-regional in 37% (14 of 38), only
systemic in 18% (7 of 38), and both local and systemic in 45%
(17 of 38). Of the 24 patients who relapsed at distant sites, 10
had brain metastases.
Gene Expression. Significant correlations were found
between ERCC1 mRNA expression and XPD mRNA expression (r ⫽ 0.48; P ⬍ 0.0001) and between RRM1 mRNA
expression and XPD mRNA expression (r ⫽ 0.48; P ⬍ 0.0001).
A nearly significant correlation was found between ERCC1
mRNA expression and RRM1 mRNA expression (r ⫽ 0.22;
P ⫽ 0.07). For RRM1 mRNA levels, patients in the bottom
quartile had a decreased risk of death compared with those in the
top quartile (RR ⫽ 0.30; 95% CI, 0.10 – 0.91; P ⫽ 0.033; Table
2). For XPD mRNA levels, patients in the bottom quartile
(0.08 – 0.71) had a decreased risk of death compared with those
in the top quartile (1.71–3.78; RR ⫽ 0.40; 95% CI, 0.12–1.37;
P ⫽ 0.145). For ERCC1 mRNA levels, patients in the bottom
quartile (2.73– 4.96) had a higher risk of death compared with
those in the top quartile (7.45–12.31; RR ⫽ 1.51; 95% CI,
0.55– 4.10; P ⫽ 0.422)
Significant differences in median survival were observed
between the 17 patients in the bottom quartile of RRM1 expression and the 15 in the top quartile (52 versus 26 months; P ⫽
0.018). Of these 17 patients in the bottom quartile, 5 underwent
a pneumonectomy with a median survival of 31.12 months, and
12 underwent a lobectomy with a median survival of 51.97
months (P ⫽ 0.191). When the characteristics of these 17
patients were examined, no differences in the initial staging
were observed in comparison with the remaining 50 patients in
the other 3 quartiles. However, for patients in the bottom quartile, radiographic response tended to be higher (65% versus
54%; P ⫽ 0.24), complete resection was attained more often
(94% versus 72%; P ⫽ 0.03), and a lobectomy was performed
more often (71% versus 34%; P ⫽ 0.004). Furthermore, pathological complete response was observed in 29% of patients in
the bottom quartile versus 0% of the remaining patients (P ⫽
0.00001). No significant differences were observed according to
ERCC1 or XPD mRNA levels (data not shown).
Table 2 Univariate Cox proportional hazards model of the RRa of
death associated with RRM1 mRNA expression levels divided
into quartiles
Quartile
RRM1
RR (95% CI)
P
1 (lowest)
2
3
4 (highest)
0.40–0.84
0.84–1.23
1.23–1.79
1.79–5.15
0.30 (0.10–0.91)
0.76 (0.30–1.90)
0.54 (0.19–1.51)
1.00
0.033
0.555
0.238
a
RR, relative risk; CI, confidence interval.
DISCUSSION
In the present study, a good correlation has been found
among ERCC1, RRM1, and XPD gene expression levels, indicating that a single assessment of one of these genes could
provide information about all three. This confirms our previous
findings of a strong correlation between ERCC1 and RRM1. We
carried out three different studies, examining individually the
role of ERCC1, RRM1, and then both, mRNA expressions in
paraffin-embedded pretreatment bronchial biopsies from gemcitabine/cisplatin-treated advanced NSCLC patients. In the first
study, median overall survival was significantly longer in patients with low ERCC1-expressing tumors than in those with
high ERCC1-expressing tumors (15 versus 5 months; P ⫽
0.009). ERCC1 mRNA expression, performance status, and
weight loss were significant independent prognostic factors
(10). Then we analyzed RRM1 expression in pretreatment bronchial biopsies from a second group of gemcitabine/cisplatintreated advanced NSCLC patients. Median time to progression
was 7.6 months for patients with low RRM1 levels and 4.3
months for those with high levels (P ⫽ 0.005). Median survival
was 15.5 months for patients with low RRM1 levels and 6.8
months for those with high levels (P ⫽ 0.002; Ref. 11). In a
third group of patients, we studied both ERCC1 and RRM1
mRNA expression in pretreatment bronchial biopsies again
from gemcitabine/cisplatin-treated advanced NSCLC patients
who were part of a large randomized trial (12). There was a
strong correlation between ERCC1 and RRM1 mRNA expression levels (r ⫽ 0.4; P ⬍ 0.001). Patients with low RRM1
mRNA levels had significantly longer median survival than
those with high levels (13.7 versus 3.6 months; P ⫽ 0.009).
There were no significant differences according to ERCC1
mRNA levels, although there was a tendency to longer median
survival among patients with low ERCC1 levels. Median survival was significantly longer among patients with low levels of
both RRM1 and ERCC1 (not reached) than among those with
high levels of both genes (6.8 months; P ⫽ 0.016; Ref. 13).
These observations confirm the preclinical data in which the
overexpression of ribonucleotide reductase confers gemcitabine
resistance in the human oropharyngeal carcinoma KB cells (14).
In the present study, patients with the lowest RRM1 levels
attained better survival, which was also correlated with a high
complete resection rate, with a median survival of 52 months.
Martini et al. (15) demonstrated for the first time that complete
resection was essential for effective disease control and longterm survival in stage IIIA N2 disease after neoadjuvant chemotherapy. Eighty-nine patients with complete resection had a
median survival of 27 months, a 3-year survival of 41%, and a
5-year survival of 26%, whereas 47 patients with incomplete or
no resection had a median survival of 12 months and a 5%
survival at 3 and 5 years (15). Several other studies (16 –18)
have reported a 40% or more 3-year survival in patients with
complete resection. Pathological complete remission was also
higher for the group of patients with the lowest RRM1 levels
(29%), both compared with other patients in this trial (0%) and
with the average reported in the literature (12%; Ref. 19). We
did not observe differences in median survival according to
surgical procedure, although a tendency toward longer survival
was observed in those patients who underwent a lobectomy.
4218s RRM1 mRNA Expression in NSCLC
Pneumonectomy has been found to be an adverse prognostic
factor in multivariate analyses (20).
Further prospective research is being carried out to test
whether patients with low RRM1 mRNA levels (bottom quartile) will obtain the maximum survival benefit from cisplatin
doublets, whereas those with high levels (top three quartiles)
could obtain better outcomes when treated with noncisplatin
doublets.
OPEN DISCUSSION
Dr. Thomas Lynch: Dr. Gandara, you have done a lot of
work in terms of thinking about how one selects chemotherapy.
What do you think is the most promising course?
Dr. David Gandara: Although all of these data are very
interesting, Dr. Rosell and I have had practical problems in
terms of how do you apply these to a patient population. The
problem of course is that our patients are very heterogeneous in
regard to all of these pathways and that it really takes a large
prospectively designed trial to validate some of these of markers. SWOG is now doing a repeat of the Noda study in small cell
lung cancer [N. Engl. J. Med., 346:85–91, 2002]. As part of that
study we are selecting genomic DNA from all the patients to
look at polymorphisms for UGT1A1 and for all of the DNA
repair genes. Among 620 patients, we will probably be able to
sort out at least that component of the polymorphisms. The NCI
Japan has agreed to provide genomic DNA from similar patients
treated there as part as a collaborative project, so we can also see
about interracial differences.
Dr. Eric Rowinsky: Given the extremely low rates of
polymorphism in the population in regard to any target protein,
do you really think any of these studies would be able to discern
if there are truly functional differences in activity in those
patients? I think the numbers required, if you really tried to do
some calculations, are astounding. I don’t think that can be
answered in clinical trials and possibly could be answered in the
laboratory if we understood the polymorphisms.
Dr. Gandara: In actuality, we have put incidence into the
statistical design, and we have very good data for the incidence
of the UGT1A1 polymorphism. If European heritage is 13% for
the 77 genotype, Hispanic 19%, African Americans 15%, and
Japanese 2%, that would predict toxicity from irinotecan, so that
could explain a lot of differences between Japan and the US. On
the basis of the incidence of the polymorphisms, we can discern
it with a 620 patient trial.
Dr. Bruce Johnson: I believe the data to support the study
design examining the role of ERCC1 was done mostly with
response to gemcitabine, is that correct? Why use docetaxel as
a control arm? Most of your results are based on about 50
patients and with your planned multivariate analysis, I would
assume the logistics of doing this trial are incredibly difficult.
You have to be able to see a difference between 180 patients.
Did you think about doing another prospective study with a
group that is homogeneously treated, rather than going straight
to a randomized study?
Dr. Rosell: Again, we have much preclinical evidence that
is used in the design of this trial. It is still relatively difficult to
organize clinical trials with mandatory biopsy and a central
review because in stage IV, as you know, at least one subset of
the patients never have biopsy, they have only positive cytology.
This kind of a study should be requested even with targeted
therapies, to have the tumor or the tissues analyzed at baseline
as a possible parameter. All these studies were analyzed in a few
patients because there were no means to find more tissue. Even
from the 600-patient Italian study, only 100 tumor samples were
available. This is one of the major pitfalls that we have today. If
I had the opportunity to reshape the study, I would put RRM1 as
a marker, to test if gemcitabine could be valid in patients with
overexpression with RRM1 with just changing the cisplatin to
an antimicrotubule drug. We are also in this study validating the
importance of BRCA1.
Dr. Paul Bunn: What really needs to happen is to validate
these assays. These quantitative PCR tests may not give you the
same result in two different laboratories.
Dr. Rosell: In the study I have presented they have the
same results. But, a major caveat: this is almost impossible
unless there is a consensus meeting of people involved in the
laboratory.
Dr. Bunn: We need to do a large randomized trial: it is
very costly and the question is whether there are really enough
data to put resources into that type of trial. There should first be
a prospective trial with a reasonable number of patients, where
you are going to give them all of the same treatment to see if this
really does predict in a large set of patients. I would submit that
trial should have two laboratories doing the laboratory tests, and
they should be blinded. If you can show that the results are
reproducible and predictive, then you could go to a prospective
trial. It is very difficult to get these samples.
Dr. Rosell: To avoid potential confusion, I will clarify:
RNA isolation can be performed in any laboratory. Quantitative
PCR analysis can be performed in any laboratory. It is not
necessary to validate. The calibration can be different, because
the values you are providing are completely different from
another laboratory. There could be consensus on the values, but
that is not absolutely necessary.
REFERENCES
1. Mountain CF. Revisions in the international system for staging lung
cancer. Chest 1997;111:1710 –7.
2. Pass HI, Pogrebniak HW, Steinberg SM, Mulshine J, Minna J.
Randomized trial of neoadjuvant therapy for lung cancer: interim analysis. Ann Thor Surg 1992;53:992– 8.
3. Rosell R, Gómez-Codina J, Camps C, et al. A randomized trial
comparing preoperative chemotherapy plus surgery with surgery alone
in patients with non-small-cell lung cancer. N Engl J Med 1994;330:
153– 8.
4. Sarries C, Haura EB, Roig B, et al. Pharmacogenomic strategies for
developing customized chemotherapy in non-small-cell lung cancer.
Pharmacogenomics 2003;3:763– 80.
5. Rosell R, Lord RVN, Taron M, Reguart N. DNA repair and cisplatin
resistance in non-small cell lung cancer. Lung Cancer 2002;38:217–27.
6. Rosell R, Taron M, Alberola V, Massuti B, Felip E. Genetic testing
for chemotherapy in non-small cell lung cancer. Lung Cancer 2003;41:
S97–102.
7. Rosell R, Crino L, Danenberg KD, et al. Targeted therapy in combination with gemcitabine in non-small cell lung cancer. Sem Oncol
2003;30:19 –25.
8. Rosell R, Taron M, Barnadas A, Scagliotti G, Sarries C, Roig B.
Nucleotide excision repair pathways involved in cisplatin resistance in
non-small cell lung cancer. Cancer Control 2003;10:297–305.
Clinical Cancer Research 4219s
9. Krafft AE, Duncan BW, Bijwaard KE, Taubenberger JK, Lichy JH.
Optimization of the Isolation and amplification of RNA from formalinfixed, paraffin-embedded tissuue: the Armed Forces Institute of Pathology experience and literatura review. Mol Diagn 1997;3:217–30.
10. Lord RVN, Brabender J., Gandara D, et al. Low ERCC1 expression
correlates with prolonged survival after cisplatin plus gemcitabine
chemotherapy in non-small-cell lung cancer Clin Cancer Res 2002;8:
2286 –91.
11. Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pretreatment biopsies from a three-arm randomized trial in metastatic
non-small-cell lung cancer. Oncogene 2003;22:3548 –53.
12. Alberola V, Camps C, Provencio M, et al. Cisplatin plus gemcitabine versus a cisplatin-based triplet versus nonplatinum sequential
doublets in advanced non-small-cell lung cancer: A Spanish Lung
Cancer Group phase III randomized trial. J Clin Oncol 2003;21:
3207–13.
13. Rosell R, Danenberg KD, Alberola V, et al. Ribonucleotide reductase messenger RNA expression and survival in gemcitabine/cisplatintreated advanced non-small cell lung cancer patients. Clin Cancer Res
2004;10:1318 –25.
14. Goan, Y-G, Zhou B, Hu E, Mi S, Yen Y. Overexpression of
ribonucleotide reductase as a mechanism of resistance to 2,2-difluorodeoxycytidine in the human KB cancer cell line. Cancer Res 1999;59:
4204 –7.
15. Martini N, Kris MG, Flehinger BJ, et al. Preoperative chemotherapy
for stage IIIa (N2) lung cancer: The Sloan-Kettering experience with
136 patients. Ann Thorac Surg 1993;55:1365–74.
16. Burkes RL, Ginsberg RJ, Shepherd FA, et al. Induction chemotherapy with mitomycin, vindesine, and cisplatin for stage III unresectable
non-small-cell lung cancer: Results of the Toronto phase II trial. J Clin
Oncol 1992;10:580 – 6.
17. Rosell R, Lopez-Cabrerizo MP, Astudillo J. Preoperative chemotherapy for stage IIIA non-small-cell lung cancer. Curr Opin Oncol
1997;9:149 –55.
18. Betticher DC, Schmitz SFH, Totsch M, et al. Mediastinal lymph
node clearance after docetaxel-cisplatin neoadjuvant chemotherapy
is prognostic of survival in patients with stage IIIA pN2 non-smallcell lung cancer: A multicenter phase II trial. J Clin Oncol 2003;21:
1752–9.
19. Pisters KMW, Kris MG, Gralla RJ, Zaman MB, Heelan RT, Martini
N. Pathologic complete response in advanced non-small-cell lung cancer following preoperative chemotherapy: Implications for the design of
future non-small-cell lung cancer combined modality trials. J Clin Oncol
1993;11:1757– 62.
20. Martin J, Ginsberg RJ, Venkatraman ES, et al. Long-term results of
combined-modality therapy in resectable non-small-cell lung cancer.
J Clin Oncol 2002;20:1989 –95.
Molecular Predictors of Response to Chemotherapy
in Lung Cancer
Rafael Rosell, Miquel Taron, Aurelio Ariza, Agusti Barnadas, Jose Luis Mate, Noemı́ Reguart, Mireia Margelı́,
Enriqueta Felip, Pedro Méndez, and Rosario Garcı́a-Campelo
Overall, chemotherapy falls short of the high expectations for improved survival in surgically resected non–
small cell lung cancer patients and prolonged survival
in the metastatic setting. Conventional chemotherapy
trials, even those including new cytotoxic drugs or
novel targeting approaches, are hampered by a lack of
genetic information. Within the global genomic-repair
pathway, overexpression of excision repair cross-complementing 1 (ERCC1) has been associated with poor
response and survival in cisplatin-treated patients. The
lack of DNA adducts in cell nuclei indicates an efficient
global genomic repair pathway, which leads to cisplatin
resistance. Several xeroderma pigmentosum (XP)
genes, including XPD, play an important role in determining the efficiency of the transcription-coupled repair pathway. XPD polymorphism has been related to
lower DNA repair capacity and enhanced cisplatin sensitivity. Other DNA repair systems are the base excision repair pathway, in which apurinic/apyrimidinic endonuclease 1 (Ape 1) plays a pivotal role, and the onestep repair pathway, where O6ⴚalkylguanine-DNA
alkyltransferase (MGMT) has a key function. MGMT
methylation can be assessed in serum DNA. By assessing ERCC1 mRNA, cisplatin adducts, XPD polymorphism, Ape 1, and MGMT, we can obtain a complete
genetic profile, which can be used in real translational
research.
Semin Oncol 31 (suppl A):000-000. © 2004 Elsevier Inc. All
rights reserved.
C
ISPLATIN is still the scaffolding of combination chemotherapy in non–small cell lung
cancer (NSCLC). Results tend to be similar
whether the partner drug is paclitaxel, docetaxel,
or gemcitabine. Similar results are generally obtained with carboplatin,1 although in a randomized study, median survival was 8.2 months in the
paclitaxel/carboplatin arm and 9.8 months in the
paclitaxel/cisplatin arm (hazard ratio, 1.22; P ⫽
.01).2 Many cytotoxic drugs induce DNA damage
similar to that caused by carcinogens. Covalent
binding of the carcinogen or cytotoxic drug results
in the formation of a chemically altered base in
DNA that is termed an adduct.3 Cisplatin has a
rigid structure with two labile chloro and two
stable ammine ligands in a cis configuration. Like
some alkylating agents, the neutral drug molecule
needs to be converted to a reactive form. This
occurs nonenzymatically in solution, where displacement reactions result in stepwise exchange of
Seminars in Oncology, Vol 31, No 1, Suppl A (February), 2004: pp 000-000
the labile chloro ligands with water molecules.
The charged aquated species are highly reactive,
but the chloro-monoaquo species is the most significant from the perspective of interaction with
DNA at physiological pH. In the case of carboplatin, which is a more stable bidentate cyclobutanedicarboxylate ligand, the aquation reaction is
much slower. This reduces drug potency, which
thereby requires a greater dose for an equivalent
antitumor effect.4 As soon as the monoaquated
species of cisplatin is formed, it reacts immediately
with a DNA base (preferentially N7 of guanine) to
form a monofunctional adduct. The remaining
chloride ligand linked to platinum in the monoadduct is then hydrolyzed, and the resulting
aquated species interacts with a second nucleophilic site to form DNA cross-links. Both 1,2- and
1,3-intrastrand DNA cross-links are formed. 1,2interstrand cross-links between opposite guanine
bases are formed preferentially in 5⬘G-C3⬘ sequences of both strands. However, mounting evidence indicates that intrastrand adducts provide
the strongest basis for the cytotoxic action of cisplatin.4
In general, the genetic mechanisms of cancer
chemoresistance are difficult to understand. Moreover, from the clinical point of view, the utility of
genetic tests is limited because of the scarcity of
tumor tissue obtained by bronchoscopy in stage IV
NSCLC patients. In early stages, we can benefit
from the resected tumor specimens that provide a
considerable amount of tumor tissue for RNA extraction. With laser-captured microdissection, we
can also retrospectively compare tumor cells with
From the Medical Oncology Service, the Pathology Department,
Hospital Germans Trias i Pujol, Badalona (Barcelona), Spain; the
Medical Oncology Service, Hospital Vall d’Hebron, Barcelona,
Spain; and the Medical Oncology Service, Hospital Juan Canalejo,
La Coruña, Spain.
Address reprint requests to Rafael Rosell, MD, Medical Oncology
Service, Hospital Germans Trias i Pujol, Ctra Canyet, s/n, Badalona (Barcelona), Spain 08916.
© 2004 Elsevier Inc. All rights reserved.
0093-7754/04/3101-0A03$30.00/0
doi:10.1053/j.seminoncol.2003.12.011
1
2
ROSELL ET AL
Fig 1. DNA repair pathways. RNA Pol II, RNA polymerase II; TFIIH, basal transcription factor; ERCC1, excision repair crossingcomplimenting 1; CSA, Cockayne syndrome A; CSB, Cockayne syndrome B; XRCC1, x-ray crossing-complimenting 1; XPA-G,
xeroderma pigmentosum A-G; RPA, replication protein A; MGMT, methylguanylmethyltransferase.
cells of the surrounding stroma to analyze loss of
heterozygosity.
To understand the cisplatin mechanisms of resistance and how to select genetic tests for immediate clinical application, it is mandatory to understand the pathways of cisplatin resistance. In
short, the DNA repair pathways are a common
denominator for carcinogenesis and cisplatin resistance. Needless to say, cisplatin resistance could
be multifaceted, including decreased drug accumulation, enhanced cellular detoxification by elevated levels of glutathione or metallothionein, and
enhanced DNA repair.
MECHANISMS OF SCANNING DNA FOR
LESIONS AND REPAIR FACTORIES
Nucleotide Excision Repair Subpathways
DNA repair is crucial for removing cisplatin
adducts. Nucleotide excision repair (NER) is the
essential pathway to protect the host from developing lung cancer and, at the same time, to generate cisplatin resistance. Ultraviolet light and cisplatin induce DNA lesions that are effective
blocks to RNA polymerase II and thus block transcription.5 These DNA lesions, including cisplatin
adducts, are removed by NER. NER can be subdivided into genetically separable subpathways
termed transcription-coupled repair (TCR) and
global genomic repair (GGR) (Fig 1).
Transcription-coupled repair (or TC-NER) repairs transcription-blocking lesions in transcribed
DNA strands of active genes, whereas GGR or
(GG-NER) repairs the lesions in the nontranscribed strand of active genes and nontranscribing
genome.6-8 To understand the numerous acronyms
used in Figs 1 to 3, it is important to clarify that
our current knowledge of the NER pathway stems
from the study of inherited genetic disorders with
deficient DNA repair systems. In humans, NER is
a major defense against the carcinogenic effects of
ultraviolet light from the sun. The severe consequences of inborn defects in this repair pathway
are apparent from the rare, autosomal recessive
disorder xeroderma pigmentosum (XP). Patients
with this disease present with hypersensitivity to
sunlight, pigmentary alterations, and premalignant
MOLECULAR PREDICTORS OF RESPONSE
3
Fig 2. Nucleotide excision repair subpathways. RNA Pol II, RNA polymerase II; CSA, Cockayne syndrome A; CSB, Cockayne
syndrome B; XPA-G, xeroderma pigmentosum A-G; TFIIH, basal transcription factor; RPA, replication protein A; ERCC1, excision
repair crossing-complimenting 1; XRCC1, x-ray crossing-complimenting 1.
lesions in the sun-exposed area of the skin, and an
extremely high incidence of skin cancer. Many
patients show accelerated neurodegeneration.9 In
terminally differentiated human neurons, GGR is
markedly attenuated while proficient repair persists in both strands of expressed genes, and the
expression of several genes involved in the incision step of NER is upregulated. It has been postulated that GGR is switched off in terminally
differentiated cells while TCR is maintained.5 In
XP, there are at least seven NER-deficient complementation groups: XPA to XPG. These groups are
defective in both NER subpathways.9 Loss of heterozygosity has been detected in several of these
groups, to a large degree in ovarian cancer and to
a lesser degree in colon and lung cancer.10
Cockayne syndrome, another photosensitive
disease associated with a NER defect, involves
postnatal growth failure, progressive neurologic
dysfunction, premature aging, and sun sensitivity,
but no cancers. Two complementation groups
have been identified: CSA and CSB. Both are
defective in functions involved in the TCR subpathway.9 XP and Cockayne syndrome offer model
systems for investigating molecular mechanisms
underlying the apoptotic response induced by ultraviolet irradiation and cisplatin.11
The left side of Fig 1 shows the TCR pathway,
where RNA polymerase II is the sensor for cisplatin damage.8 When transcribing RNA polymerase
II encounters the lesion, two transcription-coupled
repair-specific factors, CSA and CSB, are implicated for the activation of the common NER molecular pathway.11,12 The clinical implications of
TCR lie in the fact that cisplatin-resistant tumors
show an intact TCR system, while tumors are
sensitive to cisplatin when the TCR subpathway is
deficient. Conversely, the novel cytotoxic drug
ecteinascidin 743 requires a proficient TCR subpathway.13,14 In translational clinical trials, patients could be assigned to receive cisplatin- or
non– cisplatin-based chemotherapy according to
their TCR status.
For GGR, the XPC complex is activated. Along
4
ROSELL ET AL
Fig 3. DNA repair pathways and chemoresistance. MMR, mismatch repair; BER, base excision repair; TC-NER, transcriptioncoupled nucleotide excision repair; GG-NER, global genomic nucleotide excision repair; OSR, one-step repair; RNA Pol II, RNA
polymerase II; XPD, xeroderma pigmentosum D; MGMT, methylguanylmethyltransferase; Ape 1, apurinic/apyrimidinic endonuclease
1; IHC, immunohistochemistry; ERCC1, excision repair cross-complimenting 1.
with the basal transcription factor (TFIIH), an
XPG binds to the DNA around the lesion. TFIIH
contains two helicases, XPB and XPD, which open
an approximately 30-bp DNA segment around the
damage. This open intermediate is stabilized by
replication protein A and XPA. The DNA strand
that contains the damaged base(s) is excised by
the two NER endonucleases, XPG and XPF/excision repair cross-complementing 1 (ERCC1). XPG
cleaves the damaged DNA strand 3⬘ from the
lesion, and XPF/ERCC1 cleaves the damaged
strand 5⬘ from the DNA lesion. Finally, the resulting gap is filled in by DNA polymerases in the
presence of replication factors.12
XPD Polymorphism and DNA Repair Capacity
For translational research purposes, XPD is important because it intervenes in both the TCR and
the GGR subpathways. Until now, translational
research has focused on ERCC1 mRNA overexpression as an element of the GGR related to
cisplatin resistance in gastric, ovarian, and lung
cancer (Table 1).15-17 The main obstacle to testing
ERCC1 is the scarcity of tumor tissue available for
RNA isolation and quantitative polymerase chain
reaction from bronchoscopy. Conversely, XPD can
be analyzed in constitutional DNA, for example,
in DNA isolated from peripheral blood lymphocytes. In addition, XPD polymorphism has been
related to lower DNA repair capacity in several
studies.18 Approximately half of the population
examined have the genotype Lys751Lys and also
have Asp312Asp. These patients have a good
DNA repair capacity and therefore are presumably
resistant to cisplatin.18,19 In an epidemiologic
study matching 341 lung cancer cases with 360
smoker control subjects, a host-cell reactivation
assay measuring the activity of the chloramphenicol acetyltransferase gene was used in cells transfected with plasmids treated with benzo(a)pyrene
diol epoxide. DNA repair capacity was lower in
the lung cancer patients than in the controls. The
variants Gln751Gln and Asn312Asn had suboptimal DNA repair capacity, with a significant in-
MOLECULAR PREDICTORS OF RESPONSE
5
Table 1. ERCC1 as a Predictive Marker in Gastric, Colorectal, and Non–Small Cell Lung Cancer Patients
Treated With Cisplatin or Oxaliplatin
Regimen
2
Cis 100 mg/m on day 1
5-FU 200 mg/m2/day ⫻ 21 days (CI)
Oxaliplatin 130/mg/m2 every 21 days
5-FU 200 mg/m2/day ⫻ 21 days (CI)
Gem 1,250 mg/m2 on days 1 and 8
Cis 100 mg/m2 day 1 every 3 weeks
Tumor
Gastric
cancer15
Colorectal cancer16
NSCLC17
Patients
ERCC1
Cut-off
Survival
(mos)
19
19
40
10
28
28
⬍5.8
⬎5.8
⬍4.9
⬎4.9
⬍6.7
⬎6.7
NR
5.4
10.9
1.9
15
5
P Value
.03
⬍.001
.04
Abbreviations: NSCLC, non–small cell lung cancer; 5-FU, 5-fluorouracil; Gem, gemcitabine; Cis, cisplatin; NR, not reported; CI, continuous
infusion.
crease in the hazard ratio, in contrast with the
wild-type genotypes both in cases and controls,
which exhibited the most proficient DNA repair
capacity.18 The frequency of homozygous variants
is 10% for either codon. In an intermediate group
with heterozygous polymorphisms, the frequency
was 40% at either codon. This leads us to speculate
that this group could have an intermediate outcome. The clinical interest of these findings lies in
their potential usefulness in identifying constitutional DNA from lymphocyte polymorphisms associated with suboptimal DNA repair capacity and
their potential role in identifying patients with
better response to cisplatin chemotherapy.
The relationship between DNA repair capacity
and survival in NSCLC patients treated with cisplatin-based chemotherapy was recently examined
by a host-cell reactivation assay.19 In this study,
patients who had received chemotherapy were divided into quartiles according to their DNA repair
capacity. Patients in the top quartile (DNA repair
capacity ⬎9.2%) had a risk of death that was more
than two times greater than that of patients in the
bottom quartile (DNA repair capacity ⬍5.8%)
(P ⫽ .01). Median survival was 8.9 months for
patients in the top quartile compared with 15.8
months for those in the bottom quartile (P ⫽ .04).
Intriguingly, among the 36 chemotherapy-naive
patients who underwent curative surgical resection, there was a slight survival advantage associated with increased DNA repair capacity. This
finding could be extremely relevant when interpreting the results of neoadjuvant chemotherapy
trials in early NSCLC. The assessment of DNA
repair capacity, reflecting the GGR subpathway, is
warranted in such trials to identify the subgroup of
patients with low DNA repair capacity that could
have lower survival when treated with surgery
alone and at the same time could benefit from
neoadjuvant or adjuvant chemotherapy. In contrast, patients with high DNA repair capacity
could have better survival when treated with surgery alone and could be refractory to neoadjuvant
or adjuvant approaches (Table 2).
Cisplatin DNA Adducts
The absence of measurable cisplatin DNA adducts, indicating a deficiency in the GGR subpathway, has been associated with poor outcome in
NSCLC. In one study, multiple tissues, including
ovarian tumor, were obtained at autopsy from
eight patients who had received either cisplatin or
carboplatin chemotherapy. Cisplatin DNA adducts were detected in most of the tissues examined, and DNA adduct levels were similar in the
majority of tissues from the same subject, whether
taken from the bone marrow, liver, brain, or peripheral nerve.20 The assessment of DNA adduct
levels could become a predictive assay for cisplatin
and/or radiotherapy. Schaake-Koning et al21 observed an improvement in survival in patients
with locally advanced NSCLC treated with daily
radiotherapy plus daily cisplatin 6 mg/m2 approximately 1 hour before irradiation (20 administrations for a total of 120 mg/m2) compared with
radiotherapy alone. Three-year survival was 16%
for concomitant cisplatin-radiotherapy versus 2%
for radiotherapy alone. Differences in survival according to cisplatin DNA adduct levels have been
observed in patients treated with concomitant cis-
6
ROSELL ET AL
Table 2. Markers for Customized Cisplatin Therapy in Neoadjuvant or Adjuvant Trials
Marker
Assay
Poor Candidates
Good Prognosis
CTR
Good Candidates
Poor Prognosis
ERCC1
Ape 1
DRC
Cisplatin adducts
QPCR
IHC
HCRA
IHC
Overexpression
Overexpression
High DRC
Absence
⫹⫹
⫹⫹
⫹⫹⫹
⫹⫹⫹
Low expression
Low expression
To be assessed
Presence
Abbreviations: CTR, chemoresistance; QPCR, quantitative polymerase chain reaction; IHC, immunohistochemistry; DRC, DNA repair
capacity; HCRA, host-cell reactivation assay.
platin-radiotherapy. Dutch investigators22 studied
27 patients treated with daily cisplatin and radiotherapy. For assessing cisplatin DNA adduct levels, buccal cells were collected by wiping the inner
cheek with a cotton swab before cisplatin treatment and 1 hour after the fifth course of cisplatin.
The immunohistochemical method used for cytospins enabled cisplatin DNA adducts to be visualized in nuclei of the buccal cells. Nuclear signal
intensity (arbitrary units) ranged from 0.4 to 2.8.
Striking differences in survival were observed according to DNA adduct levels. Thirteen patients
with low DNA adduct levels (⬍1.16) had a median survival of 5.2 months, as compared with 14
patients with high levels (⬎1.16) who had a median survival of 30.2 months (P ⬍ .0001).22
Figures 1 and 223 illustrate the pivotal role of XPD
in cisplatin resistance. Elegant experiments show
that molecular deficiencies (in both GGR and TCR
subpathways) in primary fibroblasts confer marked
hypersensitivity to cisplatin compared with normal
primary fibroblasts. These results show that any one
deficiency in XPA, XPD, XPF, or XPG confers
marked hypersensitivity to cisplatin. Therefore, we
postulate that XPD genotypes Gln751Gln or heterozygous Lys751Gln or Asn312Asn or Asp312Asn
could have an enhanced sensitivity to cisplatin.
Base Excision Repair Pathway
Figure 3 summarizes the DNA repair pathways
in a way that may be applied to patient treatment.
In the center of the figure, we speculate that XPD
could be a determinant genetic marker, equivalent
to ERCC1. Cisplatin adducts could be a good
surrogate of the function of GGR. There is also an
additional pathway, the base excision repair, in
which apurinic/apyrimidinic endonuclease (Ape
1) plays an important role. Ape 1 is a multifunctional enzyme mediating repair of ionizing radiation and alkylating agent–induced DNA damage.
Ape 1 acts in base excision repair to hydrolyze
abasic sites arising from enzymatic removal of
damaged purine and pyrimidine bases. It has a
3⬘-phosphodiesterase activity that excises deoxyribose fragments and phosphate groups at the 3⬘
terminus of DNA strand breaks caused by ionizing
radiation, yielding a 3⬘-OH substrate for DNA
repair synthesis. Nuclear Ape 1 has been related to
improved survival in resected NSCLC, which can
be explained by the role of effective base excision
repair in repairing DNA damage (Table 2).24 Interestingly, immunostaining expression of Ape 1
has been observed in germ cell tumors from testicular cancer patients. The elevation was correlated with resistance to chemotherapy with bleomycin.25
O6-Alkylguanine-DNA Alkyltransferase and OneStep Repair
Finally, serum DNA could be useful for methylation assays. The right upper corners of Figs 1
and 3 show the one-step repair pathway as the first
mechanism in detecting DNA damage by alkylating agents. Many tumors exhibit overexpression of
the DNA repair enzyme O6⫺alkylguanine-DNA
alkyltransferase (MGMT). In addition, tumors in
which MGMT is methylated respond better to
BCNU (carmustine). The one-step repair pathway
(the direct reversal of DNA damage) targets
2-chloroethylnitrosoureas, such as carmustine and
temozolomide, both of which involve alkylation of
the O6 site of guanine. One-step repair is performed by the repair protein MGMT through direct removal of an alkyl group from the O6 atom of
MOLECULAR PREDICTORS OF RESPONSE
guanine in the DNA of cells exposed to alkylating
agents. With increasing size of the alkyl group (ⱖ
ethyl), the relative contribution of MGMT to the
repair of O6-alkylguanines in DNA decreases, and
excision repair steps in as a backup modality.23
This O6-alkylguanine DNA lesion is highly cytotoxic and correlates inversely with the activity of
MGMT, which removes the monofunctional O6
adduct from the DNA, limiting response to these
cytotoxic drugs. With methylation-specific polymerase chain reaction, 40% of brain tumors
showed no methylated MGMT, which correlated
with better response and survival in BCNUtreated patients. Anaplastic astrocytomas were
also included in this study, and striking differences
in median time to progression were observed (21
months for methylated v 8 months for unmethylated gliomas; P ⬍.001).26 Similar methylation patterns of p16, DAPK, GSTP1, and MGMT in
paired tumor and serum DNA were observed in
resected NSCLCs (Table 2).27
CLINICAL IMPLICATIONS
A study of adjuvant chemotherapy failed to
improve survival in comparison with the control
arm of surgery plus postoperative radiotherapy in
completely resected stage II/IIIA NSCLC. Median
survival was 39 months in the control arm and 38
months in the chemotherapy arm (P ⫽ .56).28
Along the same lines, an Italian study failed to
demonstrate an improvement in survival in the
chemotherapy arm (P ⫽ .58).29 No benefit was
obtained with neoadjuvant chemotherapy in a
study of stage I-IIIA NSCLC, where median survival was 36 months in the chemotherapy arm and
26 months in the control arm (P ⫽ .15).30 However, some data suggest that neoadjuvant chemotherapy could improve survival. In a study of stage
IIIA or selected IIIB NSCLC, Mattson et al31
obtained a 21-month median survival in the chemotherapy arm versus 14 months in the control
arm (P ⫽ .0014). In general, it is almost impossible
to elucidate the role of chemotherapy based on
conventional clinical trials. Genetic markers can
and should be used to identify the large subgroup
of patients that can be expected to have a good
outcome because of their own efficient DNA repair pathways and, moreover, that will have no
response to chemotherapy (Table 2). As an example, when ERCC1 was analyzed in fresh tissue from
chemotherapy-naive patients with resected NSCLC,
7
ERCC1 was overexpressed in almost half of the
patients. Patients with high ERCC1 levels had
significantly better survival rates than those with
lower levels.32 This kind of information is opening
the gates to understanding the ineffectiveness of
adjuvant chemotherapy because patients with
high levels of ERCC1 do not respond to cisplatinbased therapy, yet they have much better survival
rates. We can hypothesize that only the subgroup
of patients with low levels of ERCC1, who by
definition have a worse prognosis, will paradoxically respond to cisplatin-based chemotherapy.
Further research is warranted to validate not only
the predictive value of ERCC1 but also that of
XPD polymorphism, cisplatin adducts, Ape 1, and
MGMT methylation.
ACKNOWLEDGMENT
The authors would like to express their gratitude to Drs
Giorgio Scagliotti (Bologna, Italy); Alain Depierre (Besançon,
France); Karin Mattson (Helsinki, Finland); and Gerold Bepler
(Tampa, FL) for generously providing data from their studies,
and to Renée O’Brate and Lourdes Franquet for assistance with
the manuscript.
REFERENCES
1. Schiller JH, Harrington D, Belani CP, et al: Comparison
of four chemotherapy regimens for advanced non–small-cell
lung cancer. N Engl J Med 346:92-98, 2002
2. Rosell R, Gatzemeier U, Betticher DC, et al: Phase III
randomised trial comparing paclitaxel/carboplatin with paclitaxel/cisplatin in patients with advanced non–small-cell lung
cancer: A cooperative multinational trial. Ann Oncol 13:15391549, 2002
3. Phillips DH: The formation of DNA adducts, in Alison
MR (ed): The Cancer Handbook. London, Nature Publishing
Group, 2002, pp 293-307
4. Siddik ZH: Mechanisms of action of cancer chemotherapeutic agents: DNA-interactive alkylating agents and antitumour platinum-based drugs, in Alison MR (ed): The Cancer
Handbook. London, Nature Publishing Group, 2002, pp 12951313
5. Hanawalt PC: Controlling the efficiency of excision repair. Mut Res 485:3-13, 2001
6. May A, Nairn RS, Okumoto DS, et al: Repair of individual DNA strands in the hamster dihydrofolate reductase gene
after treatment with ultraviolet light, alkylating agents, and
cisplatin. J Biol Chem 268:1650-1657, 1993
7. McKay BC, Ljungman M, Rainbow AJ: Persistent DNA
damage induced by ultraviolet light inhibits p21waf1 and bax
expression: implications for DNA repair, UV sensitivity and
the induction of apoptosis. Oncogene 17:545-555, 1998
8. Cullinane C, Mazur SJ, Essigmann JM, et al: Inhibition of
RNA polymerase II transcription in human cell extracts by
cisplatin DNA damage. Biochemistry 38:6204-6212, 1999
9. Conforti G, Nardo T, D’Incalci M, et al: Proneness to
UV-induced apoptosis in human fibroblasts defective in tran-
FACTORES DE RESISTENCIA
A QUIMIOTERAPIA
EN CÁNCER DE PULMÓN
Miquel Taron
Institut Català d’Oncologia
Hospital Germans Trias i Pujol
Barcelona
Contenido:
Resumen de la ponencia
Bibliografía
Ponencia en “PowerPoint”
Factores de resistencia a quimioterapia
en cáncer de pulmón
Miquel Taron
Servicio de Oncología Médica
Institut Català d’Oncologia
Hospital Germans Trias i Pujol, Barcelona
l cáncer de pulmón de célula no pequeña (NSCLC) representa el 80% de los casos de cáncer de
pulmón. Este tumor es altamente quimiorresistente, metastásico de origen y de mal pronóstico con
una supervivencia global a los 5 años inferior al 15% . Estos datos son todavía más dramáticos en el
grupo de pacientes avanzados (estadios IIIB con efusión pleural y IV), donde la mediana de supervivencia
se sitúa en torno a los 8-10 meses, y sin que exista ninguna combinación de quimioterapia que demuestre
su superioridad frente a otra.
E
Actualmente los estudios dirigidos a la búsqueda de marcadores genéticos como factores de
resistencia a los distintos agentes de quimioterapia y que permitan la individualización de los tratamientos
son uno de los objetivos prioritarios de la investigación aplicada al enfermo oncológico.
Existen diferentes técnicas basadas en el análisis de DNA, RNA y proteínas que pueden utilizarse
para dirigir este objetivo, aunque cabe destacar que en muchos casos el factor limitante es la baja
disponibilidad de las muestras tumorales. Por ejemplo, en cáncer de pulmón avanzado, únicamente se
dispone de material tumoral procedente de biopsia del 60% de los pacientes. Además, este material
suele obtenerse de muestras fijadas en formol e incluidas en parafina y contiene un número bajo de
células tumorales, lo que dificulta todavía más, desde el punto de vista metodológico, las estrategias
técnicas a desarrollar.
Dentro de los agentes más utilizados en el tratamiento del NSCLC cabe destacar el cisplatino
y carboplatino que son el eje vertebral del tratamiento de quimioterapia en combinación con agentes
antimicrotúbulos (taxanos y alcaloides de la vinca) o gemcitabina. Actualmente, muchos de los estudios
de marcadores de quimiorresistencia se centran en los factores genéticos y epigenéticos relacionados
con la respuesta a estos fármacos. Por ejemplo, existen diferentes vías de reparación del DNA entre
las que cabe destacar la vía Nucleotide Excision Repair (o NER) por su papel fundamental en la capacidad
reparadora del DNA (DNA repair capacity o DRC) y por tanto en la eliminación de los aductos del
platino sobre el DNA limitando su actividad. Dentro de esta vía los genes ERCC1 y XPD son cruciales
en la capacidad de reparación del DNA y también, por tanto, en la respuesta a los tratamientos basados
en agentes platinados. Así, por ejemplo, el análisis de expresión de RNA de ERCC1 por PCR Cuantitativa
(QPCR) en biopsias previas a quimioterapia de pacientes con NSCLC avanzado tratados con
gemcitabina/cisplatino demuestra que los pacientes con niveles elevados de expresión tienen una mediana
de supervivencia de 5 meses, que es significativamente menor en relación a los pacientes con niveles
bajos de expresión, con una mediana de supervivencia de 15 meses, siendo además la expresión de
este gen un factor pronóstico independiente para la supervivencia en el análisis multivariado. Estos
resultados han sido corroborados en otros dos estudios, lo que demuestra la importancia de los niveles
de expresión de este gen en el tratamiento basado en agentes platinados. En base a estos resultados
se está desarrollando un ensayo clínico en NSCLC avanzado (en el seno del Grupo Español de Cáncer
de Pulmón-GECP) donde los pacientes son tratados de forma individualizada atendiendo a los valores
Factores de resistencia a quimioterapia en cáncer de pulmón
197
de expresión de RNA de ERCC1 analizados por QPCR en tejido tumoral obtenido de la biopsia. En
la rama control los pacientes son tratados con taxotere/cisplatino, mientras que en la rama experimental
los pacientes con niveles altos de ERCC1 son tratados con gemcitabina/taxotere (es decir, tratamiento
sin cisplatino) mientras que los pacientes con niveles bajos de expresión del gen son tratados igual que
el grupo control. En la actualidad se han incluido 320 de los 360 pacientes proyectados en este ensayo,
y el análisis interino ha demostrado un beneficio clínico de este tratamiento individualizado y que se
traduce tanto en una mejora del tiempo a la progresión como en la supervivencia.
Otro gen que puede ser utilizado en un modelo de tratamiento individualizado es ribonucleótido
reductasa (RR) M1. RR codifica una enzima limitante en la síntesis de DNA y que participa igualmente
en los procesos de reparación del DNA. La subunidad M1 (RRM1) tiene un papel importante en la
especificidad del substrato, la actividad enzimática y en el metabolismo de la gemcitabina. Igual que en
el ejemplo anterior, la sobrexpresión de RRM1 analizada por QPCR en biopsias obtenidas previas al
tratamiento en pacientes con NSCLC avanzado que han recibido gemcitabina/cisplatino presentan una
supervivencia significativamente menor que aquellos pacientes con niveles de expresión bajos.
Por último, cabe también destacar el papel en cáncer de pulmón de la expresión de BRCA1, un
gen con múltiples funciones y fundamental en la reparación del DNA. El análisis de expresión de este
gen en muestras tumorales quirúrgicas de pacientes en estadios IIB-IIIA-IIIB tratados con quimioterapia
neoadyuvante basada en platino/gemcitabina revela que los pacientes con niveles bajos (cuartil inferior)
tienen una supervivencia significativamente superior a aquellos pacientes con niveles elevados de expresión.
Existen datos en la literatura que demuestran en modelos in vitro que la elevada expresión de BRCA1
hipersensibiliza las células al tratamiento con derivados antimicrotúbulos mientras que comporta resistencia
a los agentes platinados. De esta forma los pacientes con niveles de expresión de BRCA1 altos y por
tanto resistentes a cisplatino, pueden ser tratados con agentes antimiotúbulos como taxol o taxotere
y, por tanto, el análisis de expresión de este gen debe igualmente contribuir a una mejora en la selección
individualizada de los tratamientos de quimioterapia.
Tal y como se ha comentado, el principal obstáculo en el análisis de expresión a nivel de RNA
es la escasez de tejido tumoral que se dispone de muchos pacientes, y acentuado en los pacientes con
NSCLC avanzado. Otras técnicas como el análisis de polimorfismos pueden realizarse a partir de DNA
de linfocitos y permiten por tanto estudiar nuevos marcadores en todos los pacientes con independencia
de su estadio ya que la disponibilidad de muestras en este caso no es limitante. Así, el análisis de
polimorfismos (y en concreto de SNPs o single nucleotide polymorphisms) ha emergido como una nueva
realidad en la búsqueda de factores de quimiorresistencia. Existen muchos genes polimórficos que han
demostrado un importante papel en la respuesta a quimioterapia, como por ejemplo Timidilato sintasa
y respuesta a 5-Fluorouracilo, UGT1A1 y toxicidad a CPT11, e incluso que se han relacionado con
fenómenos trombóticos (p.ej. MTHFR) e incluso el Alzheimer. Además el análisis de SNPs supone
introducir nuevos marcadores de respuesta o de toxicidad desde el punto de vista de la variabilidad
genética de cada individuo.
Por ejemplo, el gen ERCC1 presenta un SNP silente en el codón 118 (C/T) que se ha relacionado
con un mayor o menor grado de expresión del gen. Así, en pacientes con NSCLC avanzado tratados
con taxotere/cisplatino ERCC1-118(C/T) ha demostrado tener un valor predictivo para la supervivencia
en el análisis multivariado: pacientes homocigotos C/C para este gen presentan una mayor supervivencia
(no se alcanza la mediana de supervivencia a los 22 meses de seguimiento) en comparación con los
pacientes C/T o T/T en esta posición (mediana de supervivencia de 9,7 meses) (P = 0.01). Además,
los resultados de un estudio farmacogenómico en 250 pacientes con NSCLC avanzado tratados con
gemcitabina/cisplatino demuestra un beneficio opuesto, donde los pacientes con genotipo T/T tienen
198
Cáncer de pulmón
en este caso mejor supervivencia que los pacientes homocigotos para el alelo ERCC1-118(C). Estos
resultados pueden tener un claro beneficio en la selección del tratamiento basado en este caso en
taxote/cisplatino o gemcitabina/cisplatino en base al análisis de ERCC1-118(C/T).
Otro gen fundamental en la vía de reparación NER es el gen XPD. Diversos estudios han
demostrado que los pacientes portadores de las variantes homocigotas Gln751XPD (aproximadamente
el 12% de la población caucásica) presentan un menor tiempo a la progresión y supervivencia en
relación a los portadores del alelo Lys751XPD cuando son tratados con dobletes basados en cisplatino.
En base a estos resultados, los pacientes homocigotos para el alelo Gln751XPD deben ser tratados
con regímenes que no contengan derivados platinados como por ejemplo gemcitabina/taxotere o
taxotere/CPT-11. Obviamente existen miles de genes polimórficos con potencial aplicación clínica como
son EGF, IL6, RRM1, Cox 2, PPAR-γ, XRCC1, XRCC3, o Ligasa IV entre otros.
Al igual que en el caso de los polimorfismos, el análisis de metilación aberrante de los genes
supresores tumorales supone una nueva aproximación al análisis de factores de resistencia a quimioterapia.
Además, estudios de la literatura y de nuestra propia experiencia han demostrado que existe una
correlación entre los patrones de metilación de múltiples genes analizados en DNA sérico y en DNA
tumoral obtenido de la biopsia o de la pieza quirúrgica del mismo paciente.
Así, por ejemplo, la metilación aberrante del gen FANCF se ha relacionado con la sensibilidad al
cisplatino en cáncer de ovario, y la metilación del gen 14-3-3σ confiere una hipersensibilidad al cisplatino y
a la adriamicina. Estudios de nuestro laboratorio en pacientes con NSCLC avanzado tratados con
gemcitabina/cisplatino demuestran que los pacientes con metilación del gen 14-3-3σ analizado en DNA
sérico presentan un mejor pronóstico en relación a los que no presentan metilación del gen. La pérdida de
expresión del gen PTEN se ha demostrado que es el resultado de la hipermetilación en más del 30% de
glioblastomas, tumores gástricos y NSCLC. La pérdida de PTTEN activa la vía de PI3K/Akt, que se ha asociado
a resistencia a distintos agentes citotóxicos, y por tanto puede ser un marcador general de quimiorresistencia.
Los primeros pasos para la individualización de los tratamientos de quimioterapia a través del
análisis de expresión de distintos genes de reparación del DNA se ha iniciado con éxito, y la
implementación del análisis de expresión de otros muchos genes será esencial para discriminar los
mecanismos genéticos relacionados con la quimiorresistencia. Estos pasos incipientes en la individualización
de los tratamientos de quimioterapia deberán obviamente verse complementados con la inclusión de
nuevos marcadores, nuevos métodos y validarse en estudios prospectivos. De forma similar, estas
estrategias deberán implementarse en el análisis de marcadores de respuesta para las nuevas terapias
dirigidas a dianas específicas o targeted therapies.
Bibliografía
1.
Rosell R, Taron M, Ariza A, et al. Molecular predictors of response to chemotherapy in lung cancer.
Semin Oncol 31 (1 Suppl 1), 20-7; 2004.
2.
Rosell R, Taron M, Barnadas A, Scagliotti G, Sarries C, Roig B. Nucleotide excision repair pathways
involved in cisplatin resistance in non-small cell lung cancer. Cancer Control, 10(4): 297-305; 2003.
3.
Sarries C, Haura E, et al Pharmacogenomic strategies for developing customized chemotherapy
in non-small cell lung cancer. Pharmacogenomics 3(6); 763-780; 2002.
4.
Lord R, Brabender J, Gandara D, et al L et al, Low ERCC1 expression correlates with prolonged
survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer. Clin. Can. Res;
8; 2286-2291; 2002.
Factores de resistencia a quimioterapia en cáncer de pulmón
199
5.
Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pretreatment biopsies from a three-arm
randomized trial in metastatic nonsmall-cell lung cancer. Oncogene 2003; 00:1-6.
6.
Rosell R, Danenberg K, Alberola V, et al. Ribonucleotide reductase messenger RNA expression
and survival in Gemcibatine/Cisplatin-Treated advanced Non-Small Cell Lung Cancer patients.
Clin. Can. Res. (10); 1318-1325; 2004.
7.
Rosell R, Felip E, Taron M, et al. Gene expression as a predictive marker of outcome in stage
IIB-IIIA-IIIB non-small cell lung cancer after induction gemcitabine-based chemotherapy followed
by resectional surgery. Clin Cancer Res, Jun 15; 10(12): 4215S-9S; 2004.
8.
Isla D, Sarries C, Rosell R, et al. Single nucleotide polymorphisms and outcome in docetaxel–cisplatintreated advanced non-small-cell lung cancer. Ann Oncol, 15; 1194-1203, 2004.
9.
Taron M, Rosell R, Felip E, et al. BRCA1 mRNA Expression Levels as an Indicator of Chemoresistance
in Lung Cancer. Hum Mol Genetics, 2004 (accepted; in press Vol 13, 20).
10.
Balaña C, Ramirez JL, Taron M, Roussos Y, Ariza A, Ballester R; Sarries C, Mendez P, Sanchez JJ,
Rosell R. MGMT methylation in serum and tumor DNA predicts response to BCNU but not to
temozolamide plus cisplatin in glioblastoma multiforme. Clin Cancer Res, 9:1461-1468; 2003.
11.
JL Ramírez, C. Sàrries, P Lopez de Castro, et al. Methylation patterns and k-ras mutations in tumors
and paired serum of resected NSCLC patients. Cancer Letters, 193(2): 207-216; 2003.
200
Cáncer de pulmón
Factores de resistencia a quimioterapia en cáncer de pulmón
201
202
Cáncer de pulmón
Factores de resistencia a quimioterapia en cáncer de pulmón
203
204
Cáncer de pulmón
TERAPIA GÉNICA
Noemí Regüart
Institut Català d’Oncologia
Hospital Germans Trias i Pujol
Barcelona
Contenido:
Resumen de la ponencia
Bibliografía
Ponencia en “PowerPoint”
Gene therapy and cancer
vaccines for lung cancer
Noemí Regüart
Medical Oncology Service
Institut Català d’Oncologia
Hospital Germans Trias i Pujol, Barcelona
number of cancer vaccine and gene therapy approaches are being evaluated in patients with lung
cancer. Much of the focus on cancer immunotherapy has been in the area of cancer vaccine
development.
A
Gene therapy is a strategy involving the transfer of specific genetic sequences into cells to mitigate
disease. The critical components of any cancer gene therapy are indentification of the gene of potential
interest, identification of the relevant cell for gene transfer, and finally, identification of the potential vector
system for the delivery of the genetic material. Gene transfer vectors include both viral (adenovirus,
retrovirus, vaccinia virus, etc) and non-viral (liposomal vectors) agents. Adenoviral vectors are the most
common vectors used in gene transfer since are relatively easy to manufacter and have the ability to
transduce both dividing and non-dividing cells.
The most common gene therapy approaches include “gene replacement therapy” and “gene
inhibition therapy” in an attempt to reverse a malignant phenotipe, “suicide gene therapy” to induce tumor
cell destruction, “immunogene therapy” to modify genetically either the tumor cell or a component of
the immune system to induce a tumor-specific immune response. The largest human gene therapy
experience in lung cancer is with intratumoral gene replacement therapy, predominantly with p53, but
such approaches are limited to locoregional disease control. Clinical trials of intratumoral Ad-p53 gene
transfer combined with chemotherapy or radiation in advanced NSCLC have been reported and leads
to synergistic anti-tumor effects without increasing toxicity(1, 2). Unfortunately intravenous administration
of Ad-p53 as a form of systemic therapy of disseminated NSCLC is unlikely to be a viable treatment
approach because of the immunogenicity of the adenovirus and life-threatening toxicity. A variant of the
p53 gene replacement approach is the use of genetically modified adenoviruses designed to replicate
exclusively in tumor cells with impaired p53 function. One example of such approach is ONYX-015(3).
A second approach to direct targeting for cancer cells is the suicide gene approach which consists in
adenoviral transfer of an encoding prodrug-converting enzyme that transform a systemically administered
nontoxic prodrug into a toxic compound that leads to cell death. One example is the herpes simplex
thymidine kinase (HSV-tk), that converts a nontoxic nucleoside analog in gancilovir(4, 5).
Cancer vaccines incorporate a source of tumor antigens, immunologically relevant, combined with
some type of “adjuvant” to make these tumor antigens more visible to the immune system. In lung cancer,
although a number of antigens are expressed/overexpressed in a subset of patients, the relevant immunologically
dominant antigens are unknown. Cancer vaccine strategies include GM-CSF (GVAX®) gene-modified cancer
cells(6, 7), liposomal MUC1 peptide(8), Mage-3 peptide, nonspecific Mycobacterium vaccae(9), and BEC (ganglioside
GD3 anti-idiotype), among others. Preliminary human trials have demonstrated immune responses as well
as tumor regression in late stage disease and several strategies are moving into late stage clinical development.
However, the challenge remains to develop an immune monitoring system that not only evaluate the the
sensitivity but that correlates with the relevant clinical effect-tumor shrinkage.
Terapia génica
207
Bibliografía
1.
Schuler, M, Herrmann, R, De Greve, JL, et al. Adenovirus-mediated wild-type p53 gene transfer in
patients receiving chemotherapy for advanced non-small-cell lung cancer: results of a multicenter
phase II study. J Clin Oncol, 2001; 19(6): 1750-1758.
2.
Nemunaitis, J, Swisher, SG, Timmons, T, et al. Adenovirus-mediated p53 gene transfer in sequence
with cisplatin to tumors of patients with non-small-cell lung cancer. J Clin Oncol, 2000; 18(3):
609-622.
3.
Nemunaitis, J, Cunningham, C, Buchanan, A, et al. Intravenous infusion of a replication-selective
adenovirus (ONYX-015) in cancer patients: safety, feasibility and biological activity. Gene Ther,
2001; 8(10): 746-759.
4.
Sterman, DH, Treat, J, Litzky, LA, et al. Adenovirus-mediated herpes simplex virus thymidine
kinase/ganciclovir gene therapy in patients with localized malignancy: results of a phase I clinical
trial in malignant mesothelioma. Hum Gene Ther, 1998; 9(7): 1083-1092.
5.
Sterman, DH, Molnar-Kimber, K, Iyengar,T, et al. A pilot study of systemic corticosteroid administration
in conjunction with intrapleural adenoviral vector administration in patients with malignant pleural
mesothelioma. Cancer Gene Ther, 2000; 7(12): 1511-1518.
6.
Nemunaitis, J, Sterman, D, Jablons, D, et al. Granulocyte-macrophage colony-stimulating factor genemodified autologous tumor vaccines in non-small-cell lung cancer. J Natl Cancer Inst, 2004; 96(4):
326-331.
7.
Salgia, R, Lynch, T, Skarin, A, et al. Vaccination with irradiated autologous tumor cells engineered
to secrete granulocyte-macrophage colony-stimulating factor augments antitumor immunity in
some patients with metastatic non-small-cell lung carcinoma. J Clin Oncol, 2003; 21(4): 624-630.
8.
Palmer, M, Parker, J, Modi, S, et al. Phase I study of the BLP25 (MUC1 peptide) liposomal vaccine
for active specific immunotherapy in stage IIIB/IV non-small-cell lung cancer. Clin Lung Cancer,
2001; 3(1): 49-57; discussion 58.
9.
O'Brien, ME, Saini, A, Smith, IE, et al. A randomized phase II study of SRL172 (Mycobacterium
vaccae) combined with chemotherapy in patients with advanced inoperable non-small-cell lung
cancer and mesothelioma. Br J Cancer, 2000; 83(7): 853-857.
208
Cáncer de pulmón
Terapia génica
209
210
Cáncer de pulmón
Terapia génica
211
212
Cáncer de pulmón
CUIDADOS DE ENFERMERÍA
EN LAS NUEVAS
MODALIDADES TERAPÉUTICAS
Ana Jiménez
Institut Català d’Oncologia
Hospital Germans Trias i Pujol
Barcelona
Contenido:
Ponencia en “PowerPoint”
Cuidados de enfermería en las nuevas modalidades terapéuticas
215
216
Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas
217
218
Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas
219
220
Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas
221
222
Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas
223
224
Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas
225
226
Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas
227
228
Cáncer de pulmón
Cuidados de enfermería en las nuevas modalidades terapéuticas
229
AVANCES EN EL MANEJO
MULTIMODAL DEL CÁNCER
DE PULMÓN NO MICROCÍTICO
Pilar Garrido
Hospital Ramón y Cajal
Madrid
Contenido:
Resumen de la ponencia
Bibliografía
Ponencia en “PowerPoint”
Avances en el tratamiento
multimodal del cáncer de pulmón
Pilar Garrido
Servicio de oncología médica
Hospital Ramón y Cajal, Madrid
ás de un tercio de los pacientes con cáncer de pulmón no microcítico (CPNM) debutan con
enfermedad localmente avanzada. Aunque se trata de un grupo muy heterogéneo, hoy en día
sabemos que todos los subgrupos se benefician de un manejo multidisciplinario que incluya quimioterapia
(QT) y tratamiento local (cirugía, radioterapia o ambos).1-5 Tradicionalmente, se ha asociado el estadio IIIA
con un manejo de QT neoadyuvante seguido de cirugía y el estadio IIIB con un manejo de QT y
radioterapia (RT) bien secuencial bien concurrente 6-12. Sin embargo, los límites son imprecisos existiendo
datos que avalan el papel de la cirugía en subgrupos de pacientes con estadio IIIB (sobre todo en
pacientes con T4N0-1) así como del papel de la QT/RT concurrente previa a la cirugía en estadio IIIA.
M
Estadio IIIA
La publicación en los años 90 de dos estudios fase III que comparaban cirugía frente a quimioterapia
basada en cisplatino seguida de cirugía en pacientes con estadio III resecable supuso un cambio en la
práctica asistencial, al demostrar un beneficio en supervivencia para los pacientes sometidos al tratamiento
combinado13-14. La administración de QT preoperatoria permite, al menos desde un punto de vista
teórico, actuar simultáneamente sobre el tumor conocido (permitiendo de esa forma “testar”, además,
su quimiosensibilidad) y, además, actuar contra la enfermedad micrometastásica que pudiera existir.
Por ello, uno de los aspectos claves en los últimos años ha sido la búsqueda de las combinaciones de
QT más activas y con menor perfil de toxicidad en este contexto15-20. En general, se han testado las
mismas hipótesis que en la enfermedad avanzada (QT basada en platino o no, dobletes con nuevos
fármaco, tripletes, etc.) obteniéndose resultados muy interesantes. Así, la tasa de respuestas objetivas
esperable con un esquema de QT de dos fármacos y que incluya cisplatino está alrededor del 6070% y la tasa de resecabilidad supera el 50% en la mayoría de las series. En cualquier caso, siempre
debe hacerse una lectura muy detallada de las características de los pacientes incluidos en la serie
que se analice dado el peso pronóstico tan dispar de algunas de ellas.
Actualmente, también es materia de debate si debe incluirse radioterapia torácica como parte
del tratamiento preoperatorio ya que algunos estudios fase II21-24 utilizando esta estrategia obtienen una
elevada tasa de resecciones y de remisiones completas patológicas, pero a costa de una elevada toxicidad.
En este sentido, en ASCO 2004 se presentaron los datos del único estudio fase III realizado hasta ahora
en el que 558 pacientes con estadio III se aleatorizaban entre recibir cisplatino-etopósido seguido de
cirugía y luego radioterapia o cisplatino-etopósido seguido de tratamiento concurrente con
carboplatino/vindesina y radioterapia fraccionada y luego cirugía25. Las conclusiones del estudio fueron
que, con esta combinación, la asociación de RT preoperatoria no impacta en supervivencia libre de
enfermedad o supervivencia global pero sí incrementa significativamente la tasa de esofagitis severa.
La elección correcta de los pacientes que deben ser sometidos a cirugía también es muy debatida.
Algunos autores propugnan que solo deben ser intervenidos aquellos que obtengan buena respuesta
con el tratamiento de inducción mientras que otros argumentan que la tasa de respuestas radiológicas
Avances en el manejo multimodal del cáncer de pulmón no microcítico
233
no es un buen índice para valorar resecabilidad y que, en ausencia de otras estrategias curativas,
no deben ser excluidos de cirugía esos pacientes. En este sentido, un estudio fase III26 que comparaba
tratamiento de inducción con QT/RT seguido de cirugía frente a tratamiento solo con QT/RT fue
presentado el año pasado en ASCO y luego en el 10º congreso mundial de pulmón (North American
Intergroup Trial 0139). El estudio, realizado sobre 429 pacientes con estadio IIIA N2, demostró mayor
supervivencia libre de enfermedad en la rama que incluía cirugía (mediana 14 versus 11 meses, a 3
años 29% versus 19%) sin diferencia en supervivencia global o patrón de recaída y con una mayor tasa
de muertes relacionadas con el tratamiento en ese brazo (6,9% versus 1,6%). La conclusión de los
autores es que se precisa un mayor seguimiento del estudio para determinar si realmente la cirugía
prolonga la supervivencia de estos pacientes frente al tratamiento bimodal con QT/RT.
Estadio IIIB
Diversos ensayos clínicos randomizados y metaanálisis4-12 han demostrado la superioridad de la quimioterapia
basada en cisplatino asociada a radioterapia frente a la radioterapia sola en pacientes con estadio III
irresecable y buen estado general. Asimismo, las guías NCCN y ASCO recomiendan tratamiento
combinado para esos pacientes2-3. Sin embargo, la estrategia óptima está aún por definir y quedan aún
muchas preguntas por responder (la mejor secuencia de tratamiento, la elección de fármacos, el
fraccionamiento de radioterapia, etc.).
Una vez demostrada la superioridad del tratamiento combinado con QT y RT, la pregunta clave
fue si el tratamiento debía ser concurrente o secuencial. En este sentido, tres estudios fase III con diferentes
combinaciones de fármacos han sido ya comunicados. El primero de ellos, llevado a cabo en Japón
y publicado en 1999 por el West Japan Lung Cancer Group27 aleatorizó 320 pacientes a tratamiento
concurrente o secuencial junto con dos ciclos del esquema MVP (mitomicina 8 mg/m2, vindesina 3 mg/m2
y cisplatino 80 mg/m2). La radioterapia concurrente comenzaba el día 2 y se administraban 56 Gy (2
Gy por fracción, 5 fracciones semanales hasta un total de 14 fracciones seguidas de un periodo de
descanso de 10 días y luego el mismo esquema que al principio). El tratamiento con radioterapia secuencial
se realizaba al finalizar la QT. La tasa de respuestas objetivas fue 84% en el brazo concurrente y 66.4%
en el secuencial (p = 0,0002). La mediana de supervivencia (16,5 vs 13,3 meses) y la supervivencia a
largo plazo (17,9% vs 7,1%) también fueron superiores en el brazo concurrente así como la toxicidad
hematológica. Probablemente debido a la técnica de RT empleada, no hubo diferencias significativas en
la tasa de toxicidad no hematológica severa en este estudio.
Más recientemente, se han comunicado los resultados a largo plazo del estudio americano RTOG
941028-29. Seiscientos once pacientes con estadios II- III irresecables fueron aleatorizados en tres brazos.
Uno de ellos utilizaba cisplatino y vinblastina secuencial con radioterapia torácica que se iniciaba el
día 50, otro recibía el mismo esquema pero de forma concurrente y el último, recibía un esquema
concurrente con radioterapia hiperfraccionada junto a cisplatino y etopósido. La toxicidad no hematológica
aguda grado 3-4, como era de esperar, fue significativamente superior con los esquemas concurrentes
(30%, 48% y 62%, respectivamente) pero no hubo diferencias significativas en las tasas de toxicidad
tardía. Los datos de supervivencia, al igual que en el estudio japonés, fueron favorables al tratamiento
concurrente pero no al brazo con RT hiperfraccionada. Los datos fueron: medianas y supervivencia a
4 años de 14,6 meses y 12% (secuencial), 17 meses y 21% (concurrente) y 15,2 meses y 17% (concurrente
hiperfraccionada).
El tercer estudio fase III30, por el contrario, no demuestra ventaja en la supervivencia (medianas
de 13,8 versus 15,8 meses) siendo, además, la diferencia en toxicidad muy significativa (disfagia severa
0%/24% y esofagitis grado 4 0%/28%)
234
Cáncer de pulmón
Otros estudios fase II que también analizan esquemas concurrentes con distintas asociaciones de
QT se han comunicado recientemente. Así, el estudio LAMP31 que incluía 258 pacientes y analizaba tres
grupos (tratamiento secuencial, tratamiento de inducción seguido de de tratamiento concurrente y
tratamiento concurrente seguido de tratamiento de consolidación) concluye recomendando el tratamiento
concomitante seguido de la QT adyuvante utilizando la combinación paclitaxel y carboplatino. El estudio
de Zatloukal32 recomienda la combinación de vinorelbina y cisplatino concurrente con radioterapia, tras
comparar en un estudio fase II randomizado este esquema con el mismo pero administrado secuencialmente.
El grupo SWOG33 en su estudio 9594 recomienda cisplatino/etopósido concurrente con radioterapia y
seguido de 3 ciclos de consolidación con docetaxel. Por último, el CALGB34 ha testado diferentes dobletes
(cisplatino vinorelbina, paclitaxel carboplatino y cisplatino gemcitabina) con una estrategia de inducción
previa al tratamiento concurrente que demuestra la factibilidad de esas combinaciones. En cualquier caso,
existen diferentes combinaciones posibles y, si se opta por la estrategia concurrente, es fundamental un
estricto control de la toxicidad sobre todo esofágica y pulmonar.
Conclusiones
El manejo de los pacientes con cáncer de pulmón no microcítico estadio III está en constante evolución
siendo la premisa fundamental que todos se benefician de un manejo multidisciplinario. Quimioterapia,
radioterapia y cirugía son estrategias que deben combinarse para ofrecer a cada paciente la mejor
opción. Sin embargo, la existencia de múltiples aspectos por resolver hace recomendable siempre la
inclusión de los pacientes en ensayos clínicos y, por supuesto y de manera ineludible la valoración
individual de cada uno de ellos por un comité multidisciplinario con experiencia en cáncer de pulmón.
Bibliografía
1.
Paesmans M, Berghmans T, Vallot F et al. Treatment with or without chemotherapy for locally
advanced non small cell lung cancer: a systematic review by the European Lung Cancer Working
Party. Lung Cancer 2000; 9 (suppl 1): 90 (abstr 293).
2.
Pfister D, Johnson D, Azzoli C et al. American Society Of Clinical Oncology.Treatment of unresectable
non small cell lung cancer guideline: update 2003. J Clin Oncol 2004; 22: 330-353.
3.
Ettinger DS, Cox JD, Ginsberg RJ et al. NCCN non small cell lung cancer practice guidelines.
National Comprehensive Cancer Network. Oncology 1996; 10: (suppl) 81-111.
4.
Pritchard RS, Anthony SP: Chemotherapy plus radiotherapy compared with radiotherapy alone
in the treatment of locally advanced, unresectable non small cell lung cancer. A meta-analysis. Ann
Inter Med 1996; 125: 723-729.
5.
Non Small Cell Lung Cancer Collaborative Group. Chemotherapy in non small cell lung cancer:
a metaanalysis using updated data on individual patients from 52 randomized clinical trials. Br
Med J 1995; 311: 899-909.
6.
Dillman RO, Seagren SL, Propert KJ et al: A randomized trial of induction chemotherapy plus high
dose radiation versus radiation alone in stage III non small cell lung cancer. N Engl J Med 1990; 323:
940-945.
7.
Dillman R, Don J, Seagren S et al. Improved survival in stage III non small cell lung cancer: a seven
year follow-up of CALGB 8433 trial. J Nat Cancer Inst 1996; 88: 1210-1215.
Avances en el manejo multimodal del cáncer de pulmón no microcítico
235
8.
Sause WT, Scott C, Taylor S et al: Radiation Therapy Oncology Group (RTOG) 88-08 and Eastern
Cooperative Oncology Group (ECOG) 4588: Preliminary results of a phase III trial in regionally
advanced, unresectable non small cell lung cancer. J Natl Cancer Inst 1995; 87: 198-205.
9.
Sause W, Kolesar P, Taylor S et al. Final results of phase III trial in regionally advanced unresectable
non small cell lung cancer. Chest 2000; 117: 358-364.
10.
Le Chevalier T, Arriagada R, Quoix E et al: Radiotherapy alone versus combined chemotherapy
and radiotherapy in non-resectable non small cell lung cancer: first analysis of a randomized trial
in 353 patients. J Natl Cancer Inst 1991; 83: 417-423.
11.
Schaake-Koning C, van den Bogaert W, Dalesio O et al: Effect of concomitant cisplatin and
radiotherapy on inoperable non small cell lung cancer. N Engl J Med 1992; 326: 524-530.
12.
Jeremic B, Shibamoto Y, Acimovic L et al. Hyperfractionated radiation therapy with or without
concurrent low-dose daily carboplatin/etoposide for stage III non small cell lung cancer: a randomized
study. J Clin Oncol 1996: 14: 1065-1070.
13.
Rosell R, Gómez Codina J, Camps C et al. A randomized trial comparing preoperative chemotherapy
plus surgery with surgery alone in patients with non-small cell lung cancer. N Engl J Med 1994;
330: 153-158.
14.
Roth J, Fosella F, Komaki R et al. A randomized trial comparing perioperative chemotherapy and
surgery with surgery alone in resectable stage IIIA non-Small Cell Lung Cancer. J Natl Cancer
Inst 1994; 86: 673-680.
15.
Van Zandwijk N, Smit E, Kranmer G et al. Gemcitabine and cisplatin as induction regimen for
patients with biopsy-proven stage IIIAN2 Non-Small Cell Lung Cancer: a phase II study of the
EORTC lung Cancer Cooperative Group. J Clin Oncol 2000; 18: 2658-2664.
16.
Betticher D, Schmitz S, Tötsch M et al. Mediastinal lymph node clearance after docetaxel-cisplatin
neoadjuvant chemotherapy is prognostic of survival in patients with stage IIIA pN2 Non-Small
Cell Lung Cancer: a multicenter phase II trial. J Clin Oncol 2003; 21:1752-1759.
17.
Manegold C, Biesma B, Smit H et al. Docetaxel and cisplatin as induction chemotherapy in stage
IIIA N2 non-small cell lung cancer: an EORTC phase II trial (08984). Proc American Soc Clin
Oncol 2004, vol 23, 654a (#7166).
18.
Gottfried M, Ramlau R, Krzakowski M et al. Vinorelbine-based triplet with ifosfamide and cisplatin
as induction chemotherapy to increase resection rate in marginally unresectable non-small cell
lung cancer patients. Proc American Soc Clin Oncol 2004, vol 23, 654a, (# 7165).
19.
Cappuzzo F, De Marinis F, Nelli F et al. Phase II study of gemcitabine-cisplatin-paclitaxel triplet as
induction chemotherapy in inoperable, locally-advanced non-small cell lung cancer. Lung Cancer
2003; 42, 355-361.
20.
Garrido P, Moyano A, Lago J et al. Multidisciplinary approach including surgery in stage IIIB non
small cell lung cancer. Rev Oncología 1999; 1 (suppl 2): 61-69.
21.
Albain K, Rush V, Crowley J et al. Long term results after concurrent cisplatin/etoposide plus chest
radiotherapy followed by surgery in bulky stages IIIA(N2) and IIIB non small cell lung cancer: 6
year outcomes from South West Oncology Group study 8805. Proc Am Soc Clin Oncol 1999;
18: 467 a (1801).
236
Cáncer de pulmón
22.
Choi N, Carey R, Daly W et al. Potential impact on survival of improved tumor downstaging and
resection rate by preoperative twice-daily radiation and concurrent chemotherapy in stage IIIA
non small cell lung cancer. J Clin Oncol 1997; 15: 712-717.
23.
Eberhardt W, Wilke H, Stamatis M et al. Preoperative chemotherapy followed by concurrent
chemoradiation therapy based on hyperfractionated accelerated radiotherapy and definitive surgery
in locally advanced non small cell lung cancer: mature results of a phase II trial. J Clin Oncol 1998;
16: 622-634.
24.
Thomas M, Rube C, Semik M et al. Impact of preoperative bimodality induction including twicedaily radiation on tumor regression and survival in stage III non small cell lung cancer. J Clin Oncol
1999; 17: 1185-1193.
25.
Thomas M, Macha H, Ukena D et al. Cisplatin / etoposide followed by twice-daily chemoradiation
versus cisplatin / etoposide alone before surgery in stage III non-small cell lung cancer: a randomized
stage III trial of the German Lung Cancer Cooperative Group. Proc American Soc Clin Oncol
2004, vol 23, 616a (#7004).
26.
Albain K, Scout C, Rush V et al. Phase III study of concurrent chemotherapy and full course
radiotherapy versus CT/RT induction followed by surgical resection for stage IIIA (pN2) nonsmall cell lung cancer: first outcome analysis of North American Intergroup trial 0139 (RTOG
93-09). Lung Cancer 2003; 41: S4.
27.
Furuse K, Fukuoka M, Kawahara M et al: Phase III study of concurrent versus sequential thoracic
radiotherapy in combination with mitomycin, vindesine and cisplatin in unresectable stage III non
small cell lung cancer. J Clin Oncol 1999; 17: 2692-2699.
28.
Movsas B, Scott C, Curran W et al. A Quality-adjusted time without symptoms or toxicity
(QTWiST) analysis of RTOG 9410. Proc Amer Soc Clin Oncol 2001; 20; 291a (# 1247).
29.
Curran W, Scott C, Langer C, et al. Long-term benefit is observed in a phase III comparison of
sequential versus concurrent chemoradiation for patients with unresected stage III non small cell
lung cancer: Radiation Therapy Oncology Group 9410. Proc Amer Soc Clin Oncol 2003; 22;621
(#2499).
30.
Pierre F, Maurice P, Gilles R et al. A randomized phase III trial of sequential chemoradiotherapy
versus concurrent chemo-radiotherapy in locally advanced non small cell lung cancer. GLOT-GFPC
NPC 9501 study. Proc Amer Soc Clin Oncol 2001; 20: abstr 1246.
31.
Bonomi P, Curran W, Choy H et al. Randomized 3-arm phase II study of paclitaxel, carboplatin,
and thoracic radiation for patients with stge III NSCLC. Report of Locally Advanced Multimodality
Protocol. Lung Cancer 2003; 41 (Suppl 2), S77 (# 0-263).
32.
Zatloukal P, Petruzelka L, Zemanova M et al. Concurrent versus sequential radiochemotherapy
with vinorelbine plus cisplatin in locally advanced NSCLC. A radomized phase II study. Long-term
follow-up data. Lung Cancer 2003; 41 (Suppl 2), S76 (# 0-262).
33.
Gandara D, Chansky K, Albain K et al. Consolidation docetaxel after concurrent chemoradiotherapy
in stage IIIB non small cell lung cancer: phase II SWOG 9504. J Clin Oncol 2003; 21 (10): 2004-10.
34.
Vokes E, Herndon JE, Crawford J et al: Randomized phase II trial of cisplatin with gemcitabine or
paclitaxel or vinorelbine as induction chemotherapy followed by concomitant chemoradiotherapy
for stage III non small cell lung cancer. J Clin Oncol 2002; 20: 4191-4198.
Avances en el manejo multimodal del cáncer de pulmón no microcítico
237
238
Cáncer de pulmón
Avances en el manejo multimodal del cáncer de pulmón no microcítico
239
240
Cáncer de pulmón
Avances en el manejo multimodal del cáncer de pulmón no microcítico
241
242
Cáncer de pulmón
Avances en el manejo multimodal del cáncer de pulmón no microcítico
243
244
Cáncer de pulmón
Avances en el manejo multimodal del cáncer de pulmón no microcítico
245
246
Cáncer de pulmón
ACTUALIZACIÓN DEL TRATAMIENTO
DE CÁNCER DE PULMÓN
José Miguel Sánchez Torres
Instituto Catalán de Oncología
Hospital Germans Trias i Pujol
Barcelona
Contenido:
Resumen de la ponencia
Bibliografía
Actualización del tratamiento
del cáncer de pulmón
José Miguel Sánchez Torres
Servicio de oncología médica
Instituto Catalán de Oncología
Hospital Germans Trias i Pujol, Badalona (Barcelona)
l cáncer de pulmón es la neoplasia más frecuente y la principal causa de muerte por cáncer. Alrededor
del 80% pertenecen a la variedad histológica de cáncer de pulmón no microcítico (CPNM). De
ellos un tercio son resecables en el momento del diagnóstico. La resección quirúrgica es el tratamiento
estándar en los estadios iniciales de la enfermedad. Sin embargo, sólo el 50% de ellos estará curado a
los 5 años a pesar de la resección completa de la enfermedad. La supervivencia en estos estadios
precoces disminuye en relación directa al tamaño del tumor y a la afectación ganglionar. La supervivencia
a los 5 años oscila entre el 67% en estadio IA (pT1N0) y el 39% en estadio pIIB (pT2 N1)(1).
E
En la actualidad se está evaluando el efecto de la quimioterapia pre y postoperatoria en los
estadios iniciales resecables de la enfermedad. La quimioterapia preoperatoria podría aumentar la
supervivencia en estadios I y II con respecto a la cirugía sola(2). El papel de la quimioterapia adyuvante
en determinados subgrupos de pacientes ha sido establecido con los resultados de los últimos estudios
completados.
El Grupo Español de Cáncer de Pulmón (GECP) tiene en marcha el ensayo NATCH en pacientes
con estadios iniciales, los cuales son aleatorizados a una de las tres ramas de tratamiento: cirugía sola,
quimioterapia preoperatoria con paclitaxel-carboplatino, o bien quimioterapia postoperatoria. Los resultados
preliminares muestran un claro efecto de la quimioterapia neoadyuvante en la reducción del tamaño
tumoral.
El metaanálisis del año 1995 concluyó que el tratamiento adyuvante con combinaciones basadas
en platinos incrementa la supervivencia a 5 años en un 5% y reduce el riesgo de muerte en un 13%
frente a la resección quirúrgica sola, aunque esta diferencia no alcanzaba la significación estadística
(HR 0,87, P = 0,08)(3).
Estos resultados han sido confirmados por el estudio del grupo IALT (International Adjuvant Lung
Cancer Trial) en pacientes con estadios I, II y III(4). La quimioterapia postoperatoria incrementó la
supervivencia a 5 años de los pacientes en un 4.1% en comparación con los pacientes tratados únicamente
con resección quirúrgica (44,5% vs 40,4%; P < 0,03).
Recientemente, dos estudios aleatorizados demuestran un beneficio estadísticamente significativo de
la quimioterapia adyuvante en estadios precoces. El estudio CALGB 9633, en pacientes con estadio IB
(T2 N0), reportó un beneficio de la quimioterapia postoperatoria con paclitaxel y carboplatino tanto
en la supervivencia global a los 4 años (71% vs 59%, P = 0.028), como en la supervivencia libre de
recaida (61% vs 50%, P = 0,035)(5). En el estudio canadiense, el tratamiento adyuvante con vinorelbina
y cisplatino supuso un incremento del 15% en la supervivencia global (69% vs 54%, P = 0,002), y del
13% en la supervivencia libre de recidiva (61% vs 48%, P = 0,012), ambas a los 5 años, en pacientes
con estadio IB y II(6).
Actualización del tratamiento de cáncer de pulmón
249
Ahora bien, puesto que sabemos que alrededor de la mitad nunca va a recidivar, un enfoque
racional sería el tratamiento adyuvante solo a los pacientes con alto riesgo de recidiva. El análisis de
marcadores pronósticos podría definir el grupo de pacientes resecados con mayor probabilidad de
recurrencia. En estos pacientes, la identificación de marcadores predictivos genéticos podría identificar
subgrupos quimiorresistentes y quimiosensibles frente a determinados agentes.
La enfermedad localmente avanzada o estadio III supone el 20-30% de los pacientes al diagnóstico.
El estadio IIIA incluye los casos con extensión locorregional T3 N1 y T1-3 N2. A pesar de ser técnicamente
resecables, tienen una supervivencia a los 5 años del 10-15%. Los principales factores pronósticos son
la afectación ganglionar y la resección completa. La quimioterapia neoadyuvante ha demostrado incrementar
la supervivencia de estos pacientes(7, 8). El estadio IIIB incluye pacientes clásicamente considerados
irresecables, cuya supervivencia a los cinco años es del 5%. En estos pacientes la radioterapia concomitante
con quimioterapia, bien precedida de quimioterapia de inducción, o bien seguida de quimioterapia de
consolidación, es el tratamiento que consigue un mayor beneficio en la supervivencia.
El 40-50% de los pacientes tienen una enfermedad en estadio IV o metastático en el momento
del diagnóstico. Los platinos (cisplatino y carboplatino) se consideran el elemento imprescindible en el
tratamiento de estos tumores. Datos procedentes de ocho ensayos que utilizaron tratamiento con
quimioterapia basada en cisplatino mostraron un incremento del 10% en la supervivencia a 1 año y de
1.5 meses en la mediana de supervivencia(3). Después de más de dos décadas de ensayos clínicos
evaluando la eficacia de distintas combinaciones de un platino más otro agente, se ha llegado a lo que
podríamos denominar un techo terapéutico. Un ensayo llevado a cabo por el Southwest Oncology
Group concluyó que la mediana en la supervivencia con vinorelbina-cisplatino era similar a la obtenida
con paclitaxel/carboplatino: 8,1 y 8,6 meses, respectivamente(9). Más recientemente, el Eastern Cooperative
Oncology Group desarrolló un ensayo aleatorizado a cuatro ramas de tratamiento y observó una tasa
global de respuestas del 19%, una supervivencia mediana de 7.9 meses, una supervivencia a 1 año de
33%, y de 11% a los 2 años(10). No se encontraron diferencias en la eficacia de los cuatro esquemas
de quimioterapia basados en platino (cisplatino-paclitaxel, cisplatino-gemcitabina, cisplatino-docetaxel, y
carboplatino-paclitaxel). En el Italian Lung Cancer Project, los pacientes eran aleatorizados a recibir
gemcitabina/cisplatino o paclitaxel/carboplatino o vinorelbina/cisplatino. De nuevo, no se encontraron
diferencias en la tasa de respuestas (30%), tiempo hasta la progresión (4,6 meses), ni en la supervivencia
mediana (9,8 meses)(11).
En este contexto son necesarios nuevos enfoques en el tratamiento del cáncer de pulmón. Uno
sería la investigación de nuevos agentes que actúan contra determinadas dianas moleculares, realizando
su acción en pasos muy específicos del complejo proceso de proliferación y diferenciación celular. Otro
sería la identificación de marcadores genéticos predictivos de quimiorresistencia que nos puedan definir
subgrupos de pacientes que van a poder beneficiarse del tratamiento con determinadas combinaciones
de agentes quimioterápicos.
Las vías de reparación de ADN juegan una importante función en la resistencia a la quimioterapia.
El análisis de la expresión de genes que intervienen en la reparación de ADN puede ayudarnos a
individualizar la combinación óptima de agentes quimioterápicos. Los genes ERCC1 (Excision Repair
Cross-Complementing 1), RR (Ribonucleotide Reductase) y BRCA1 (Breast Cancer 1) intervienen de forma
crucial en las vías de reparación de ADN.
La sobreexpresión de ERCC1 en tejido tumoral se ha asociado con resistencia a cisplatino en
pacientes con CPNM tratados con gemcitabina y cisplatino. La mediana en la supervivencia de los
pacientes con bajo nivel de expresión de ERCC1 fue de 15 meses, mientras que en aquellos con alto
nivel de expresión fue solo de 5 meses (P = 0,009). El análisis multivariable identificó la expresión de
250
Cáncer de pulmón
este gen como factor pronóstico de supervivencia junto con la pérdida de peso y el Performance
Status(12). El GECP está finalizando el reclutamiento de pacientes en un ensayo farmacogenómico
aleatorizado en el que el esquema de quimioterapia en la rama experimental depende de la expresión
de ERCC1: docetaxel-cisplatino si la expresión es baja, y una combinación sin platino si ésta es alta,
docetaxel-gemcitabina. Los datos preliminares indican una mayor eficacia en los pacientes tratados en
la rama experimental.
RR es una enzima limitante clave en la síntesis de ADN. Además la subunidad RRM1 interviene
en el metabolismo de la gemcitabina y en la reparación de ADN. La sobreexpresión de RRM1 se ha
correlacionado con la resistencia a gemcitabina tanto in vitro como en pacientes con CPNM tratados
con cisplatino y gemcitabina.
El análisis en la expresión de RRM1 en biopsias de pacientes italianos tratados dentro de un
ensayo aleatorizado(11), reveló diferencias estadísticamente significativas en la supervivencia del grupo de
pacientes tratados con gemcitabina y cisplatino. La supervivencia mediana fue de 15,5 meses en aquellos
con un nivel bajo de RRM1 y de 6,8 meses en aquellos con un nivel alto (P = 0,0028). El tiempo a
la progresión también resultó superior en los pacientes con niveles bajos (P = 0,05)(13).
Entre 1988 y 2000 el GECP desarrolló un ensayo aleatorizado comparando gemcitabinacisplatino versus gemcitabina-cisplatino-vinorelbina versus gemcitabina-vinorelbina seguido de vinorelbinaifosfamida(14). En el grupo asignado a gemcitabina-cisplatino, la supervivencia mediana en los pacientes
con baja expresión de RRM1 era superior a la de los que tenían alta expresión en el tejido tumoral:
13,7 meses vs 3,6 meses (P = 0,009), así como el tiempo hasta la progresión: 8,4 meses vs 2,7 meses
(P = 0,020)(15).
BRCA1 es un gen que juega un papel crucial en varias de las vías de reparación del ADN. Su
expresión se ha relacionado con resistencia a quimio y radioterapia. Estudios preclínicos sugieren que
una expresión reducida de BRCA1 incrementa la sensibilidad a agentes que producen un daño en el
ADN, como cisplatino, por promover la reparación del ADN y la supervivencia celular, con inhibición
de la apoptosis. En contraste con este efecto, una expresión elevada de BRCA1 aumenta la sensibilidad
de los agentes antimicrotúbulos por inducir la apoptosis en respuesta a dichos agentes(16)
La expresión reducida de BRCA1 en una línea celular de cáncer de mama determinó una gran
sensibilidad a cisplatino y etopósido y una gran resistencia a agentes que actúan sobre los microtúbulos,
como paclitaxel y vincristina(17). La reconstitución del gen BRCA1 resultó en un incremento en la
resistencia a cisplatino y también en la sensibilidad a agentes antimicrotúbulos(18, 19).
En un grupo de 55 pacientes estadios IIB, IIIA y IIIB que fueron resecados después de recibir
quimioterapia neoadyuvante con gemcitabina y cisplatino se realizó una cuantificación de la expresión
de BRCA1 ARNm en tejido tumoral parafinado, y esta expresión génica se dividió en cuartiles. La
supervivencia no se ha alcanzado en los pacientes en el cuartil con menor expresión de BRCA1, es
de 37.8 meses en los pacientes incluidos en los dos cuartiles medios, y es de 12,7 meses en aquellos
en el cuartil superior, y esta diferencia es estadísticamente significativa (P = 0,01)(20)
Los inhibidores de la tirosín kinasa del receptor del factor de crecimiento epidérmico (EGFR)
son pequeñas moléculas que compiten con el ATP en su unión a la tirosín kinasa del EGFR, con lo cual
inhiben su autofosforilación y la posterior activación en cascada de señalizaciones que conducen a la
multiplicación celular, bloqueando el proceso de proliferación y metastatización. La presencia de mutaciones
en el dominio tirosín kinasa del EGFR se ha identificado como el mayor determinante de respuesta a
agentes inhibidores de dicha tirosín kinasa. Varios trabajos han descrito estas mutaciones y su correlación
con sensibilidad a inhibidores de EGFR. La mayoría de las mutaciones se localizan en los exones 18, 19
Actualización del tratamiento de cáncer de pulmón
251
y 21, y consisten en delecciones y en sustitución de aminoácidos. Estos estudios muestran una alta
frecuencia de mutaciones en pacientes con histología de adenocarcinoma, mujeres, no fumadores y
asiáticos. Aquellos pacientes con mutaciones tratados con un inhibidor de EGFR pueden conseguir una
inusual larga supervivencia(21, 22, 23, 24).
El GECP en su compromiso para mejorar el tratamiento y pronóstico de los pacientes con cáncer
de pulmón, tiene previsto iniciar en los próximos meses varios ensayos clínicos farmacogenómicos con
el objetivo de evaluar la expresión de RRM1 y de BRCA1 como potenciales marcadores predictivos
de quimiorresistencia, tanto en la enfermedad metastásica como en neoadyuvancia y en adyuvancia.
En esta misma línea se contempla el análisis de mutaciones en el dominio tirosín kinasa del EGFR
en el tejido tumoral de los pacientes con histología de adenocarcinoma y posterior tratamiento con
agentes inhibidores del mismo, como gefitinib o erlotinib.
La individualización del tratamiento de acuerdo a la expresión de marcadores predictivos de
respuesta a agentes quimioterápicos y a inhibidores moleculares de la proliferación celular podría mejorar
de forma significativa el pronóstico de los pacientes con cáncer de pulmón, y dará lugar a un cambio
radical en la práctica clínica habitual
Bibliografía
1.
Mountain CF. Revisions in the international system for staging lung cancer. Chest 1997; 111: 17101717.
2.
Depierre A, Milleron B, Moro-Sibilot D, et al. Preoperative chemotherapy followed by surgery
compared with primary surgery in respectable stage I (except T1N0), II, and IIIa non-small cell
lung cancer. J Clin Oncol 2002; 20: 247-253.
3.
Non-small Cell Lung Cancer Collaborative Group. Chemotherapy in non-small cell lung cancer:
a meta-analysis using updated data on individual patients from 52 randomised clinical trials. Br
Med J 1995; 311: 899-909.
4.
The International Adjuvant Lung Cancer Trial Collaborative Group. Cisplatin-based Adjuvant
Chemotherapy In Patients With Completely Resected NSCLC, N Engl J Med 2004; 350: 351-360.
5.
Strauss GM, Maddaus MA, Johnson EA, et al. Randomized clinical trial of adjuvant chemotherapy
with paclitaxel and carboplatin following resection in stage IB non-small cell lung cancer. Report
of Cancer and Leukemia Group B (CALGB) Protocol 9633. Proc Am Soc Clin Oncol 2004;
23: 7019.
6.
Winton TL, Livingston R, Johnson D, et al. A prospective randomized trial of adjuvant vinorelbine
and cisplatin in completely resected stage IB and II non-small cell lung cancer (Intergroup Trial
JBR. 10). Proc Am Soc Clin Oncol 2004; 23: 7018.
7.
Rosell R, Gómez Codina J, Camps C et al. A randomized trial comparing preoperative chemotherapy
plus surgery with surgery alone in patients with non-small cell lung cancer et al. N Engl J Med
1994; 330: 153-158.
8.
Roth JA, Fossella F, Komaki R et al. A randomized trial comparing perioperative chemotherapy
and surgery with surgery alone in resectable stage IIIA non-small-cell lung cancer. J Natl Cancer
Inst 1994; 86: 673-680.
252
Cáncer de pulmón
9.
Kelly K, Crowley J, Bunn PA, et al. Randomized phase III trial of paclitaxel plus carboplatin versus
vinorelbine plus cisplatin in the treatment of patients with advanced non-small cell lung cancer:
a Southwest Oncology Group trial. J Clin Oncol 2001; 19: 3210-8.
10.
Schiller JH, Harrington D, Belani CP, et al. Comparison of four chemotherapy regimens for advanced
non-small-cell lung cancer. N Engl J Med 2002; 346: 92-98.
11.
Scagliotti GV, De Marinis F, Rinaldi M, et al. Phase III randomized trial comparing three platinumbased doublets in advanced non-small cell lung cancer. J Clin Oncol 2002; 20: 4285-4291.
12.
Lord RVN, Brabender J, Gandara D, et al. Low ERCC1 expression correlates with prolonged
survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer. Clin Cancer
Res 2002; 8: 2286-2291.
13.
Rosell R, Scagliotti G, Danenberg KD, et al. Transcripts in pretreatment biopsias from a three arm
randomized trial in metastatic non-small cell lung cancer. Oncogene 2003; 22: 3548-3553.
14.
Alberola V, Camps C, Provencio M, et al. Cisplatin plus gemcitabine versus a cisplatin-based triplet
versus nonplatinum sequential doublets in advanced non-small cell lung cancer: a Spanish Lung
Cancer Group Phase III randomized trial. J Clin Oncol 2003; 21: 3207-3213.
15.
Rosell R, Danenberg KD, Alberola V, et al. Ribonucleotide reductase Messenger RNA expression
and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clin
Cancer Res 2004; 10: 1318-1325.
16.
Kennedy RD, Quinn JE, Mullan PB, et al.The role of BRCA1 in the celular response to chemotherapy.
J Natl Cancer Inst 2004; 96: 1659-1668.
17.
Lafarge S, Sylvain V, Ferrara M, et al. Inhibition of BRCA1 leads to increased chemoresistance to
microtubule-interfering agents, an effect that involves the JNK pathway. Oncogene 2001; 20: 65976606.
18.
Mullan PB, Quinn JE, Gilmore PM, et al. BRCA1 and GADD45 mediated G2/M cell cycle arrest
in response to antimicrotubule agents. Oncogene 2001; 20: 6123-6131.
19.
Quinn JE, Kennedy RD, Mullan PB, et al. BRCA1 functions as a differential modulator of
chemotherapy-induced apoptosis. Cancer Res 2003; 63: 6221-6228.
20.
Taron M, Rosell R, Felip E, et al. BRCA1 mRNA expression levels as an indicator of chemoresistance
in lung cancer. Hum Mol Genet 2004; 13: 2443-2449.
21.
Lynch TJ, Bell DW, Sordilla R, et al. Activating mutations in the epidermal groth factor receptor
underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004; 350: 21292139.
22
Paez JG. Jänne PA, Lee JC, et al. EGFR mutations in lung cancer : correlation with clinical response
to gefitinib therapy. Science 2004; 304: 1497-1500.
23.
Pao W, Miller V, Zukowski M, et al. EGF receptor gene mutations are common in lung cancer
from “never smokers” are associated with sensitivity of tumors to gefitinib and erlotinib. PNAS
2004; 101: 13306-13311.
24.
Miguel Taron,Yukito Ichinose, Rafael Rosell, et al. Activating mutations in the tyrosine kinase domain
of the epidermal growth factor receptor are associated with gefitinib response in chemorefractary
lung adenocarcinomas. Clin Cancer Res 2005 (in press).
Actualización del tratamiento de cáncer de pulmón
253
La edición de esta publicación ha sido posible gracias a la colaboración de: